View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1390R-Insertion-17 (Length: 245)
Name: NF1390R-Insertion-17
Description: NF1390R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1390R-Insertion-17 |
 | |
|
| [»] chr5 (2 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 148; Significance: 3e-78; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 94 - 245
Target Start/End: Complemental strand, 11639543 - 11639392
Alignment:
| Q |
94 |
gtcttgtctcatatttgtcttccagtaactattactgctttagagttttgggttttgacctttacagtctttgattttctttttatgaggtaaattgcat |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11639543 |
gtcttgtctcatatttgtcttccagtaactagtactgctttagagttttgggttttgacctttacagtctttgattttctttttatgaggtaaattgcat |
11639444 |
T |
|
| Q |
194 |
gttgatctagcattcttgtgtcatatgccatatagcatatctcattattttc |
245 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11639443 |
gttgatctagcattcttgtgtcatatgccatatagcatatctcattattttc |
11639392 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 8 - 46
Target Start/End: Complemental strand, 11639610 - 11639572
Alignment:
| Q |
8 |
aattgtcaactaccattatattaccatagtatatgactt |
46 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11639610 |
aattgtcaactaccattatattaccatagtatatgactt |
11639572 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University