View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1390R-Insertion-19 (Length: 115)
Name: NF1390R-Insertion-19
Description: NF1390R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1390R-Insertion-19 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 107; Significance: 4e-54; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 107; E-Value: 4e-54
Query Start/End: Original strand, 9 - 115
Target Start/End: Original strand, 28210027 - 28210133
Alignment:
| Q |
9 |
agaggaatggctttggtggttgtggccagaaggcacttcgaaggctacacgacgacctgatttgcgacaactgttggtggatgaattcttcaccaacaca |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28210027 |
agaggaatggctttggtggttgtggccagaaggcacttcgaaggctacacgacgacctgatttgcgacaactgttggtggatgaattcttcaccaacaca |
28210126 |
T |
 |
| Q |
109 |
ggtttgc |
115 |
Q |
| |
|
||||||| |
|
|
| T |
28210127 |
ggtttgc |
28210133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University