View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1390_high_102 (Length: 321)
Name: NF1390_high_102
Description: NF1390
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1390_high_102 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 30 - 310
Target Start/End: Original strand, 8088234 - 8088513
Alignment:
| Q |
30 |
ctcaaagctttcaatacataggttggtgtcccttggaggatgcaggctagatggcataattgcatgcattactgcaagcagatcaattgctctttttctc |
129 |
Q |
| |
|
|||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8088234 |
ctcaaagctttcaatacacaggttggtgtgccttggaggatgcaggctagatggcataattgtatgcattactgcaagcagatcaattgctctttttctc |
8088333 |
T |
 |
| Q |
130 |
atgcgctcagagaaggcaacttagtggctgatactttggccaaaaatggccaaagccttgctttgtactcttcacaatggtgggatctcccccctccctt |
229 |
Q |
| |
|
||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
8088334 |
atgcgctcaaagaagtcaacttagtggctgatactttggccaaaaatggccaaagccttgctttgtactcttcacaatggtgggatc-accccctccctt |
8088432 |
T |
 |
| Q |
230 |
tgtagccacctacctttatagggattctctagggctgccttttactagattttccatggattgattttgtatatggttcat |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
8088433 |
tgtagccacctacctttatagggattctctagggctgccttttactagattttccatggattaattttgtatatggttcat |
8088513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 163 - 214
Target Start/End: Original strand, 25061561 - 25061612
Alignment:
| Q |
163 |
ctttggccaaaaatggccaaagccttgctttgtactcttcacaatggtggga |
214 |
Q |
| |
|
|||||||||| |||||| ||||||||||| |||||||||| ||||||||||| |
|
|
| T |
25061561 |
ctttggccaagaatggcgaaagccttgctatgtactcttcccaatggtggga |
25061612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 34; Significance: 0.0000000005; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 138 - 199
Target Start/End: Complemental strand, 44652485 - 44652424
Alignment:
| Q |
138 |
agagaaggcaacttagtggctgatactttggccaaaaatggccaaagccttgctttgtactc |
199 |
Q |
| |
|
|||||||||||||| ||||||||| | ||||| || ||||||||| | |||||||||||||| |
|
|
| T |
44652485 |
agagaaggcaacttggtggctgatgccttggctaagaatggccaaggtcttgctttgtactc |
44652424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 135 - 215
Target Start/End: Original strand, 786993 - 787073
Alignment:
| Q |
135 |
ctcagagaaggcaacttagtggctgatactttggccaaaaatggccaaagccttgctttgtactcttcacaatggtgggat |
215 |
Q |
| |
|
||||||||||| ||||| || || ||| | || ||||| ||||||||||||||||| ||| ||| || |||||||||||| |
|
|
| T |
786993 |
ctcagagaagggaacttggtagcagatgccttagccaagaatggccaaagccttgccatgttctcctctcaatggtgggat |
787073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University