View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1390_high_103 (Length: 319)

Name: NF1390_high_103
Description: NF1390
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1390_high_103
NF1390_high_103
[»] chr3 (1 HSPs)
chr3 (98-285)||(21121238-21121424)


Alignment Details
Target: chr3 (Bit Score: 150; Significance: 3e-79; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 150; E-Value: 3e-79
Query Start/End: Original strand, 98 - 285
Target Start/End: Complemental strand, 21121424 - 21121238
Alignment:
98 cttcatacctttcttggagaggaattctcaataagcagtactcagtctgttggcttagctaagttgagaaacggatgctagaaggataattgtgtggtgt 197  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
21121424 cttcatacctttcttggagaggaattctcaataagcagtactcagtctgttggcttagctaagttgagaaacggatgctagaaggataattgtgtggtgt 21121325  T
198 ttttgcactttatccttagacataagatattattattgcnnnnnnnnnnngttggaaaggataatatgatattattgtttggtcacag 285  Q
    |||||||||||||||||||||||||||||||||||||||           ||||||||||||||||||||||||||||||||||||||    
21121324 ttttgcactttatccttagacataagatattattattgc-ttttttttttgttggaaaggataatatgatattattgtttggtcacag 21121238  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University