View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1390_high_106 (Length: 312)

Name: NF1390_high_106
Description: NF1390
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1390_high_106
NF1390_high_106
[»] chr1 (1 HSPs)
chr1 (193-299)||(1052001-1052107)


Alignment Details
Target: chr1 (Bit Score: 107; Significance: 1e-53; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 193 - 299
Target Start/End: Original strand, 1052001 - 1052107
Alignment:
193 aatataacactttgtccatctttcaatcttcttgtaaccacattattagaatatgtaaatatctttattacagattctaatacccatcatgaaaccactc 292  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1052001 aatataacactttgtccatctttcaatcttcttgtaaccacattattagaatatgtaaatatctttattacagattctaatacccatcatgaaaccactc 1052100  T
293 ataagta 299  Q
    |||||||    
1052101 ataagta 1052107  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University