View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1390_high_115 (Length: 283)

Name: NF1390_high_115
Description: NF1390
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1390_high_115
NF1390_high_115
[»] chr5 (2 HSPs)
chr5 (115-272)||(11639386-11639543)
chr5 (29-67)||(11639572-11639610)


Alignment Details
Target: chr5 (Bit Score: 154; Significance: 1e-81; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 154; E-Value: 1e-81
Query Start/End: Original strand, 115 - 272
Target Start/End: Complemental strand, 11639543 - 11639386
Alignment:
115 gtcttgtctcatatttgtcttccagtaactattactgctttagagttttgggttttgacctttacagtctttgattttctttttatgaggtaaattgcat 214  Q
    ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
11639543 gtcttgtctcatatttgtcttccagtaactagtactgctttagagttttgggttttgacctttacagtctttgattttctttttatgaggtaaattgcat 11639444  T
215 gttgatctagcattcttgtgtcatatgccatatagcatatctcattattttctttcat 272  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
11639443 gttgatctagcattcttgtgtcatatgccatatagcatatctcattattttctttcat 11639386  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 29 - 67
Target Start/End: Complemental strand, 11639610 - 11639572
Alignment:
29 aattgtcaactaccattatattaccatagtatatgactt 67  Q
    |||||||||||||||||||||||||||||||||||||||    
11639610 aattgtcaactaccattatattaccatagtatatgactt 11639572  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University