View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1390_high_131 (Length: 252)

Name: NF1390_high_131
Description: NF1390
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1390_high_131
NF1390_high_131
[»] chr3 (1 HSPs)
chr3 (1-195)||(25412405-25412594)


Alignment Details
Target: chr3 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 1 - 195
Target Start/End: Original strand, 25412405 - 25412594
Alignment:
1 tgtcgattttatcatattataataggtggaaaatatacaattatcctaaattttatgactcgattatcttgaattattgcaggtggatttgcatgtaaat 100  Q
    ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||    
25412405 tgtcgattttatcatataataataggtggaaaatatacaattatcctaaattttatgactcgat-atcttgaattattgcaggtggatttgcatgtaaat 25412503  T
101 taaataaacccaattgggccttgggatcatattagaccaattcatgatcgaa-tttgtacccgcatgcataaccatggacgaaacttttttaccag 195  Q
         | ||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||    
25412504 -----atacccaattgggccttgggatcatattagaccaattcatgatcgaagtttgtaccagcatgcataaccatggacgaaacttttttaccag 25412594  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University