View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1390_high_146 (Length: 243)
Name: NF1390_high_146
Description: NF1390
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1390_high_146 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 1 - 214
Target Start/End: Complemental strand, 2813531 - 2813318
Alignment:
| Q |
1 |
cttttatcctactcatttcaccacacgtgatgaatgtccagataattaatatcccacaattaattactatcccaagtctaagcaattgggaacagaagca |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2813531 |
cttttatcctactcatttcaccacacgtgatgaatgtccagatgattaatatcccacaataaattactatcccaagtctaagcaattgggaacagaagca |
2813432 |
T |
 |
| Q |
101 |
aagtgttttgatctagaaaaggtgggaagggaaaaattaggaacacagagaaattgctgcagaaaaattgggaataagtgtgatgaagacgagagaagat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2813431 |
aagtgttttgatctagaaaaggtgggaagggaaaaattaggatcacaaagaaattgctgcagaaaaattgggaataagtgtgatgaagacgagagaagat |
2813332 |
T |
 |
| Q |
201 |
gcgtgtgatgaaga |
214 |
Q |
| |
|
||||||||||||| |
|
|
| T |
2813331 |
acgtgtgatgaaga |
2813318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University