View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1390_high_148 (Length: 238)
Name: NF1390_high_148
Description: NF1390
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1390_high_148 |
| |
|
Alignment Details
Target: chr4 (Bit Score: 107; Significance: 9e-54; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 107; E-Value: 9e-54
Query Start/End: Original strand, 34 - 148
Target Start/End: Complemental strand, 54084782 - 54084668
Alignment:
Q |
34 |
ccaccaccgcgacttctaccaccggatcccgaaccagcccgagagcctgcatatgagcctgcctccgaccctgccccagaaccggaaccggaactagaag |
133 |
Q |
|
|
||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
54084782 |
ccaccactgcgacttctaccacctgatcccgaaccagcccgagagcctgcatatgagcctgcctccgaccctgccccagaaccggaaccggaactagaag |
54084683 |
T |
|
Q |
134 |
atgaagatgatgatg |
148 |
Q |
|
|
||||||||||||||| |
|
|
T |
54084682 |
atgaagatgatgatg |
54084668 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 34 - 140
Target Start/End: Complemental strand, 54081379 - 54081273
Alignment:
Q |
34 |
ccaccaccgcgacttctaccaccggatcccgaaccagcccgagagcctgcatatgagcctgcctccgaccctgccccagaaccggaaccggaactagaag |
133 |
Q |
|
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||| || || |||||||||| |
|
|
T |
54081379 |
ccaccaccgcgacttctaccacctgatcccgaaccagcccgagagcctgcatatgagcctgcttccgaccctgccccggaaccagacccagaactagaag |
54081280 |
T |
|
Q |
134 |
atgaaga |
140 |
Q |
|
|
| ||||| |
|
|
T |
54081279 |
acgaaga |
54081273 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 41
Target Start/End: Complemental strand, 54084842 - 54084802
Alignment:
Q |
1 |
ccttcaccataaccagagccctgcccatagcctccaccacc |
41 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
54084842 |
ccttcaccataaccagagccctgcccatagcctccaccacc |
54084802 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 4 - 41
Target Start/End: Complemental strand, 54081460 - 54081423
Alignment:
Q |
4 |
tcaccataaccagagccctgcccatagcctccaccacc |
41 |
Q |
|
|
|||||||||||||||||||||||| ||||||||||||| |
|
|
T |
54081460 |
tcaccataaccagagccctgcccagagcctccaccacc |
54081423 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 4468 times since January 2019
Visitors: 5894