View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1390_high_151 (Length: 230)
Name: NF1390_high_151
Description: NF1390
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1390_high_151 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 93; Significance: 2e-45; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 3 - 95
Target Start/End: Original strand, 1116539 - 1116631
Alignment:
| Q |
3 |
atcagtatcatggctttaccactcgtcatctccgttttcaaacctctctcaaccaccacccccctccactctacacttctacgccgccgctgt |
95 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1116539 |
atcagtatcatggctttaccactcgtcatctccgttttcaaacctctctcaaccaccacccccctccactctacacttctacgccgccgctgt |
1116631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 186 - 230
Target Start/End: Complemental strand, 36170805 - 36170761
Alignment:
| Q |
186 |
cctttattttgcatatttcatccttagtaaccatctttggagaat |
230 |
Q |
| |
|
|||||||||||| ||||||| |||||||| ||||||||||||||| |
|
|
| T |
36170805 |
cctttattttgcgtatttcaaccttagtagccatctttggagaat |
36170761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University