View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1390_high_159 (Length: 210)

Name: NF1390_high_159
Description: NF1390
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1390_high_159
NF1390_high_159
[»] chr3 (2 HSPs)
chr3 (97-204)||(44840631-44840736)
chr3 (1-48)||(44840785-44840832)


Alignment Details
Target: chr3 (Bit Score: 85; Significance: 1e-40; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 97 - 204
Target Start/End: Complemental strand, 44840736 - 44840631
Alignment:
97 gtgttctgtctgagttcgtaaccaagtgttgattatgatgcccctttttgagtgtgtgtatatgtatacctgcttcattaggttaacatttctctgtata 196  Q
    |||||||||||||||||||||||||||||||||||| ||||||||||||||||  |||||||||||||| ||||||||||||||||||||||||||||||    
44840736 gtgttctgtctgagttcgtaaccaagtgttgattataatgcccctttttgagt--gtgtatatgtatacttgcttcattaggttaacatttctctgtata 44840639  T
197 ttgttgga 204  Q
    ||| ||||    
44840638 ttggtgga 44840631  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 44840832 - 44840785
Alignment:
1 ttttgtgttttgaacggttgtgatgaagcagtgtaaaaagtgaactag 48  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||    
44840832 ttttgtgttttgaacggttgtgatgaagcagtgtaaaaagtgaactag 44840785  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University