View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1390_low_110 (Length: 321)
Name: NF1390_low_110
Description: NF1390
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1390_low_110 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 168; Significance: 5e-90; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 168; E-Value: 5e-90
Query Start/End: Original strand, 53 - 321
Target Start/End: Original strand, 34315765 - 34316013
Alignment:
| Q |
53 |
tcatgatgctcttaaattggattctgctgatatcaaatacccagtttgccatttccttggtaataaggccattatgtgggtccctaatttccttggcaac |
152 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34315765 |
tcatgatgctcttaaattggattctgctgatatcaaatacccagtttgccatttccttggcaataaggccattatgtgggtccctaatttccttggcaac |
34315864 |
T |
 |
| Q |
153 |
gttgatgtttagttggccccttaagcaatttctaatgctgtatttaaataaattattgttgtgtattgtgtgnnnnnnnncaattctgaggatttgaact |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || | | ||||||||||| ||||||| |
|
|
| T |
34315865 |
gttgatgtttagttggccccttaagcaatttctaatgctgtatttaaataaattattgttgtgtgtttttt--------ttaattctgaggagttgaact |
34315956 |
T |
 |
| Q |
253 |
tgtgacttctttatgagtccaagtcttgtaccaaatcatcttgtccctccaagatactgtgctggaatt |
321 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
34315957 |
tgtgacttc------------agtcttgtaccaaatcatcttgtccctccaagacactgtgctggaatt |
34316013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University