View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1390_low_119 (Length: 313)

Name: NF1390_low_119
Description: NF1390
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1390_low_119
NF1390_low_119
[»] chr7 (1 HSPs)
chr7 (29-209)||(34771106-34771286)


Alignment Details
Target: chr7 (Bit Score: 169; Significance: 1e-90; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 29 - 209
Target Start/End: Complemental strand, 34771286 - 34771106
Alignment:
29 atataaagcaatgatgtaaaatggactataatctttcaaagaatcaagacttgttgaccaagtcataattttgggcataactcattacattcaagatcat 128  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||    
34771286 atataaagcaatgatgtaaaatggactataatctttcaaagaatcaagacttgttgaccaagtcataatttggggcataactcattacattcaagatcat 34771187  T
129 tttcaatgacgggaatcaagatggactaaaatctttcaaagaatcagacttctggcaaataactctgcattactcatactt 209  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||    
34771186 tttcattgacgggaatcaagatggactaaaatctttcaaagaatcagacttttggcaaataactctgcattactcatactt 34771106  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University