View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1390_low_119 (Length: 313)
Name: NF1390_low_119
Description: NF1390
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1390_low_119 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 169; Significance: 1e-90; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 29 - 209
Target Start/End: Complemental strand, 34771286 - 34771106
Alignment:
| Q |
29 |
atataaagcaatgatgtaaaatggactataatctttcaaagaatcaagacttgttgaccaagtcataattttgggcataactcattacattcaagatcat |
128 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
34771286 |
atataaagcaatgatgtaaaatggactataatctttcaaagaatcaagacttgttgaccaagtcataatttggggcataactcattacattcaagatcat |
34771187 |
T |
 |
| Q |
129 |
tttcaatgacgggaatcaagatggactaaaatctttcaaagaatcagacttctggcaaataactctgcattactcatactt |
209 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
34771186 |
tttcattgacgggaatcaagatggactaaaatctttcaaagaatcagacttttggcaaataactctgcattactcatactt |
34771106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University