View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1390_low_123 (Length: 304)
Name: NF1390_low_123
Description: NF1390
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1390_low_123 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 7 - 255
Target Start/End: Complemental strand, 8839493 - 8839245
Alignment:
| Q |
7 |
agcttgtggcttgcctagcattttcatgttatgagcattgagcactaccttggtagtgcccctagaaaatagttgtcgtgcctaaggcgtttcttttaga |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||| |||||||||| | |
|
|
| T |
8839493 |
agcttgtggcttgcctagcattttcatgttatgagcattgagcactaccttggtagtgcccctaggaaatagttgtcgtgcttaaggtgtttcttttaaa |
8839394 |
T |
 |
| Q |
107 |
ttaaattaataattgtaaaaagaaaaatagttatttagtcggagttttaaatcataaatggtctcacttgtagttgagaaaaattcagctacattgactt |
206 |
Q |
| |
|
|||||||||||||| ||||||||||| |||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
8839393 |
ttaaattaataattttaaaaagaaaattagttatttagttggagttttaaatcataaatggtctcacttatagttgagaaaaattcagctacattgactt |
8839294 |
T |
 |
| Q |
207 |
taactatcttcaatttgactcgtaatatttctgttatactaatgcgttt |
255 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||| |||||| |
|
|
| T |
8839293 |
taactatcttcaatttgactcgtaatatttctcttatactaaagcgttt |
8839245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University