View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1390_low_132 (Length: 281)

Name: NF1390_low_132
Description: NF1390
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1390_low_132
NF1390_low_132
[»] chr1 (1 HSPs)
chr1 (60-241)||(4871937-4872118)


Alignment Details
Target: chr1 (Bit Score: 178; Significance: 5e-96; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 178; E-Value: 5e-96
Query Start/End: Original strand, 60 - 241
Target Start/End: Complemental strand, 4872118 - 4871937
Alignment:
60 ggatattaagaagggaagaaaaaagagcgatataatcggatatggtagagtaaccgcgagagagcatgtcatcgaaatcacgagtagcagaattgatata 159  Q
    ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4872118 ggatattaagaagggaagaaaaaagagcgttataatcggatatggtagagtaaccgcgagagagcatgtcatcgaaatcacgagtagcagaattgatata 4872019  T
160 agctattgtttccttcacccatttatagtaacaaggaggacgaggaagaggaggcatgtctatgaatggatcacaagtataa 241  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4872018 agctattgtttccttcacccatttatagtaacaaggaggacgaggaagaggaggcatgtctatgaatggatcacaagtataa 4871937  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University