View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1390_low_134 (Length: 276)
Name: NF1390_low_134
Description: NF1390
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1390_low_134 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 217; Significance: 1e-119; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 30 - 254
Target Start/End: Original strand, 3623733 - 3623957
Alignment:
| Q |
30 |
attttgtcatctttcataccctcaatgaaacacaatttttccatcacaagcaatatggacccccttactttttggtttgttagaaaacaaattattttac |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
3623733 |
attttgtcatctttcataccctcaatgaaacacaatttttccatcacaagcaatatggaccccctttctttttggtttgttagaaaacaaattattttac |
3623832 |
T |
 |
| Q |
130 |
ggaggacacacctcatgcaagatcaaagaaaaccacaaattttattaaatatttataataaaatttacatataacctatcaacgacataattccatatta |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
3623833 |
ggaggacacacctcatgcaagatcaaagaaaaccacaaattttattaaatatttataataaaatttacgtataacctatcaacgacataattccatatta |
3623932 |
T |
 |
| Q |
230 |
gaaccgaaatcacaactagtgtgag |
254 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
3623933 |
gaaccgaaatcacaactagtgtgag |
3623957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 141 - 204
Target Start/End: Complemental strand, 30868255 - 30868192
Alignment:
| Q |
141 |
ctcatgcaagatcaaagaaaaccacaaattttattaaatatttataataaaatttacatataac |
204 |
Q |
| |
|
|||||| ||||||| ||| ||||| |||||||||||| ||||| |||||||||||| |||||| |
|
|
| T |
30868255 |
ctcatgtaagatcagagagaaccatcaattttattaaagatttacaataaaatttacgtataac |
30868192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University