View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1390_low_136 (Length: 271)

Name: NF1390_low_136
Description: NF1390
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1390_low_136
NF1390_low_136
[»] chr5 (1 HSPs)
chr5 (49-241)||(3167098-3167288)


Alignment Details
Target: chr5 (Bit Score: 162; Significance: 2e-86; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 162; E-Value: 2e-86
Query Start/End: Original strand, 49 - 241
Target Start/End: Complemental strand, 3167288 - 3167098
Alignment:
49 acatatagagccacccatttggccattgtttttggagttagaaaaagcatgacaacgtttcttttttcagttcaatgtgtacaacgttgtctttgtacgt 148  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3167288 acatatagagcaacccatttggccattgtttttggagttagaaaaagcatgacaacgtttcttttttcagttcaatgtgtacaacgttgtctttgtacgt 3167189  T
149 atggttactattgaatttaactggtatggactgatatagtgaggagtacgggacgacgggtatccatggaccatggccaggtacccctctctg 241  Q
    |||||||||||||||||||||||||||||||||||||  ||||||| |||||| ||||||||||||||||||||| ||||||||| |||||||    
3167188 atggttactattgaatttaactggtatggactgatat--tgaggaggacgggatgacgggtatccatggaccatgtccaggtacctctctctg 3167098  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University