View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1390_low_137 (Length: 270)
Name: NF1390_low_137
Description: NF1390
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1390_low_137 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 236; Significance: 1e-130; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 7 - 260
Target Start/End: Original strand, 15695352 - 15695602
Alignment:
| Q |
7 |
atatgaaagagaaattatttaaaagtttgtattcaactgactactactttgtttgccggcctccaagtttaattaaattgttatatttccttataaaatt |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15695352 |
atatgaaagagaaattatttaaaagtttgtattcaactgactactactttgtttgccggcctccaagtttaattaaattgttatatttccttataaaatt |
15695451 |
T |
 |
| Q |
107 |
gacctggttttccatgctttgcattaagtataatacaaaatgtagttaagttttgactaatgatttctctaccaacttgtcttgctttatctttaattaa |
206 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15695452 |
gacctggttttccatgctttgcattaagt---atacaaaatgtagttaagttttgactgatgatttctctaccaacttgtcttgctttatctttaattaa |
15695548 |
T |
 |
| Q |
207 |
tgttttctatacagcagtacgtattttaaggttgtatcgctcttactgtctctg |
260 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15695549 |
tgttttctatacagcagtacgtattttaaggttgtatcgctcttactgtctctg |
15695602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 159 - 200
Target Start/End: Original strand, 15691201 - 15691242
Alignment:
| Q |
159 |
ttgactaatgatttctctaccaacttgtcttgctttatcttt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15691201 |
ttgactaatgatttctctaccaacttgtcttgctttatcttt |
15691242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University