View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1390_low_143 (Length: 265)
Name: NF1390_low_143
Description: NF1390
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1390_low_143 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 146; Significance: 5e-77; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 43 - 265
Target Start/End: Complemental strand, 26411433 - 26411213
Alignment:
| Q |
43 |
agaggggggatacaaaatgtaaacaaataggtaaattgaattttgtcaaccagttgcttaatatctactgccttgccagagaacactagatcgttacgag |
142 |
Q |
| |
|
|||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
26411433 |
agaggggggatacaaaatacaaacaaaaaggtaaattgaattttgtcaaccagttgcttaatatctaccgccttgccagagaacactagatcgttacgag |
26411334 |
T |
 |
| Q |
143 |
caaaccatatagaccacacaactaaatgtcaaatcaacnnnnnnnnntaaaccattgaaagttcactctctcagggaacatgcaacacccctcnnnnnnn |
242 |
Q |
| |
|
|||||||||| ||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26411333 |
caaaccatatggaccacacaactaaatgccaaatcaac--aaaaaaataaaccattgaaagttcactctctcagggaacatgcaacacccctcaaaaaga |
26411236 |
T |
 |
| Q |
243 |
tctaacacatccctcggaaagac |
265 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
26411235 |
tctaacacatccctcggaaagac |
26411213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University