View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1390_low_149 (Length: 252)
Name: NF1390_low_149
Description: NF1390
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1390_low_149 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 1 - 195
Target Start/End: Original strand, 25412405 - 25412594
Alignment:
| Q |
1 |
tgtcgattttatcatattataataggtggaaaatatacaattatcctaaattttatgactcgattatcttgaattattgcaggtggatttgcatgtaaat |
100 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
25412405 |
tgtcgattttatcatataataataggtggaaaatatacaattatcctaaattttatgactcgat-atcttgaattattgcaggtggatttgcatgtaaat |
25412503 |
T |
 |
| Q |
101 |
taaataaacccaattgggccttgggatcatattagaccaattcatgatcgaa-tttgtacccgcatgcataaccatggacgaaacttttttaccag |
195 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
25412504 |
-----atacccaattgggccttgggatcatattagaccaattcatgatcgaagtttgtaccagcatgcataaccatggacgaaacttttttaccag |
25412594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University