View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1390_low_162 (Length: 250)
Name: NF1390_low_162
Description: NF1390
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1390_low_162 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 108; Significance: 2e-54; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 122 - 237
Target Start/End: Complemental strand, 37804256 - 37804141
Alignment:
| Q |
122 |
ataaaattttagacaaatattttattacacaaaaagtatcactttaattttcgttttatgcctcagaatatgttggaccgaccatgctcgtaacctgaac |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
37804256 |
ataaaattttagacaaatattttattacacaaaaagaatcactttaattttcgttttatgcctcagaatatgttggaccggccatgctcgtaacctgaac |
37804157 |
T |
 |
| Q |
222 |
tttttctttcatttct |
237 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
37804156 |
tttttctttcatttct |
37804141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 1 - 77
Target Start/End: Complemental strand, 37804345 - 37804269
Alignment:
| Q |
1 |
ctgctctagattctatgtcgttatttaaatcttatcgttcatttgcttttaaatactcaataaagcgaccatgaata |
77 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
37804345 |
ctgctctagattctatgtcgttattcaaatcttatcgttcatttgcttttaaatactcaacaaagcgaccatgaata |
37804269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University