View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1390_low_171 (Length: 228)

Name: NF1390_low_171
Description: NF1390
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1390_low_171
NF1390_low_171
[»] chr8 (1 HSPs)
chr8 (20-112)||(1116539-1116631)


Alignment Details
Target: chr8 (Bit Score: 93; Significance: 2e-45; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 20 - 112
Target Start/End: Original strand, 1116539 - 1116631
Alignment:
20 atcagtatcatggctttaccactcgtcatctccgttttcaaacctctctcaaccaccacccccctccactctacacttctacgccgccgctgt 112  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1116539 atcagtatcatggctttaccactcgtcatctccgttttcaaacctctctcaaccaccacccccctccactctacacttctacgccgccgctgt 1116631  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University