View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1390_low_174 (Length: 221)
Name: NF1390_low_174
Description: NF1390
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1390_low_174 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 75; Significance: 1e-34; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 1 - 87
Target Start/End: Complemental strand, 18978470 - 18978384
Alignment:
| Q |
1 |
ggtttacttgttaatgagacccattaaacccgaatatccatttttacattccaaaaaattgtaggatattctcacgcttcaaacttt |
87 |
Q |
| |
|
||||||||||||| |||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18978470 |
ggtttacttgttagtgagacccattaaatccgaaaatccatttttacattccaaaaaattgtaggatattctcacgcttcaaacttt |
18978384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 19 - 100
Target Start/End: Original strand, 19028218 - 19028299
Alignment:
| Q |
19 |
acccattaaacccgaatatccatttttacattccaaaaaattgtaggatattctcacgcttcaaactttttgtctagcttta |
100 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||| |||| | |||| |||||||| |||| ||||||| |||||| ||||| |
|
|
| T |
19028218 |
acccattaagcccgaatacccatttttacattccgaaaattcttagggtattctcatgctttaaactttgtgtctaacttta |
19028299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University