View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1390_low_183 (Length: 207)
Name: NF1390_low_183
Description: NF1390
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1390_low_183 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 125; Significance: 1e-64; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 125; E-Value: 1e-64
Query Start/End: Original strand, 1 - 149
Target Start/End: Complemental strand, 45623643 - 45623496
Alignment:
| Q |
1 |
taatgtctgtttggcaagttttataatgaaatagggattttgcaatattcagtttaagttgaattgcagctttaacagtggcagtctactagctttggtg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||| |||||||||||||||||| |
|
|
| T |
45623643 |
taatgtctgtttggcaagttttataatgaaatagggattta-caatattcagtttaagttgaattgcatctttaacagtggtagtctactagctttggtg |
45623545 |
T |
 |
| Q |
101 |
gtgtatgctaagatacaatttaaactcaaaggatcacaagttttgatga |
149 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45623544 |
gtgtatgctatgatacaatttaaactcaaaggatcacaagttttgatga |
45623496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 97; Significance: 7e-48; HSPs: 4)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 97; E-Value: 7e-48
Query Start/End: Original strand, 37 - 149
Target Start/End: Original strand, 7934719 - 7934831
Alignment:
| Q |
37 |
attttgcaatattcagtttaagttgaattgcagctttaacagtggcagtctactagctttggtggtgtatgctaagatacaatttaaactcaaaggatca |
136 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7934719 |
attttgcaatattcagtttcagttgaattgcagctttaacagtggtagtctactggctttggtggtgtatgctaagatacaatttaaactcaaaggatca |
7934818 |
T |
 |
| Q |
137 |
caagttttgatga |
149 |
Q |
| |
|
|||||| |||||| |
|
|
| T |
7934819 |
caagttctgatga |
7934831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 89; E-Value: 4e-43
Query Start/End: Original strand, 37 - 149
Target Start/End: Complemental strand, 34578965 - 34578853
Alignment:
| Q |
37 |
attttgcaatattcagtttaagttgaattgcagctttaacagtggcagtctactagctttggtggtgtatgctaagatacaatttaaactcaaaggatca |
136 |
Q |
| |
|
||||||||||||||| ||| | ||||||||||||||||||||||| | |||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
34578965 |
attttgcaatattcaatttcatttgaattgcagctttaacagtggtaatctactagctttggtggtgtattctaagatacaatttaaactcaaaggatca |
34578866 |
T |
 |
| Q |
137 |
caagttttgatga |
149 |
Q |
| |
|
||||||||||||| |
|
|
| T |
34578865 |
caagttttgatga |
34578853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 37
Target Start/End: Original strand, 7934622 - 7934658
Alignment:
| Q |
1 |
taatgtctgtttggcaagttttataatgaaataggga |
37 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7934622 |
taatgtctgtttggcaagttttataatgaaataggga |
7934658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 37
Target Start/End: Complemental strand, 34579062 - 34579026
Alignment:
| Q |
1 |
taatgtctgtttggcaagttttataatgaaataggga |
37 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34579062 |
taatgtctgtttggcaagttttataatgaaataggga |
34579026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 71; Significance: 2e-32; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 71; E-Value: 2e-32
Query Start/End: Original strand, 59 - 149
Target Start/End: Original strand, 29846966 - 29847055
Alignment:
| Q |
59 |
ttgaattgcagctttaacagtggcagtctactagctttggtggtgtatgctaagatacaatttaaactcaaaggatcacaagttttgatga |
149 |
Q |
| |
|
|||||||| |||||||||||||| | ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29846966 |
ttgaattgtagctttaacagtggtaatctactagctt-ggtggtgtatgctaagatacaatttaaactcaaaggatcacaagttttgatga |
29847055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 67; E-Value: 6e-30
Query Start/End: Original strand, 59 - 149
Target Start/End: Original strand, 29867160 - 29867249
Alignment:
| Q |
59 |
ttgaattgcagctttaacagtggcagtctactagctttggtggtgtatgctaagatacaatttaaactcaaaggatcacaagttttgatga |
149 |
Q |
| |
|
|||||||| |||||||||||||| | ||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
29867160 |
ttgaattgtagctttaacagtggtaatctactagctt-ggtggtgtatgctaagatacaatttaaactcaaaggatcgcaagttttgatga |
29867249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University