View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1390_low_52 (Length: 456)
Name: NF1390_low_52
Description: NF1390
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1390_low_52 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 101; Significance: 7e-50; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 101; E-Value: 7e-50
Query Start/End: Original strand, 191 - 315
Target Start/End: Complemental strand, 27623372 - 27623248
Alignment:
| Q |
191 |
atttttatgacccagatctaccctttttccttacttgttttatgtaatgtagggtctcaaagattataaagaaaatgaagagagnnnnnnnngacacaag |
290 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
27623372 |
atttttatgacccagatctaccctttttccttacttgttttatgtaatgtagggtctcaaagattataaagaaaatgaagagagaaaaaaaagacacaag |
27623273 |
T |
 |
| Q |
291 |
tgagttttgttattctttttgcatc |
315 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
27623272 |
tgagttttgttattctttttgcatc |
27623248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 59; E-Value: 8e-25
Query Start/End: Original strand, 377 - 443
Target Start/End: Complemental strand, 27623185 - 27623119
Alignment:
| Q |
377 |
gaggttttgatagaacaatgtagcttttgtttagagtttctgtacctgtgaacttctaaggcaacag |
443 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||| |
|
|
| T |
27623185 |
gaggttttgatagaacaatgtagcttttgttaagagtttttgtacctgtgaacttctaaggcaacag |
27623119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University