View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1390_low_71 (Length: 381)
Name: NF1390_low_71
Description: NF1390
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1390_low_71 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 355; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 355; E-Value: 0
Query Start/End: Original strand, 3 - 373
Target Start/End: Complemental strand, 5553560 - 5553190
Alignment:
| Q |
3 |
caatgggatgaatgtgaaatgtgcgataaattaggacttacactaattgaagggacatgtggtcttgtcttgcatactgactacttggttgtaatgcagt |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5553560 |
caatgggatgaatgtgaaatgtgcgataaattaggacttacactaattgaagggacatgtggtcttgtcttgcatactgactacttggttgtaatgcagt |
5553461 |
T |
 |
| Q |
103 |
catttgactactactggattgtaatccagaaacttgaaagtatccacgagactcatattgctgctgctgattctgagactgcatagattcatagtttgtg |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
5553460 |
catttgactactactggattgtaatccagaaacttgaaagtatccacgagactcatattgctgctgctgattctgagactgcataggttcatagtttgtg |
5553361 |
T |
 |
| Q |
203 |
cctccaggcaacatactcatattaatattgctatggtggctgtggttcctctcactttcagctatctacacacaccaaaatcataaaaccataagatact |
302 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
5553360 |
cctccaggcaacatactcatattaatattgctatggtggctatggttcctctcactttcagctatctatacacaccaaaatcataaaaccataagatact |
5553261 |
T |
 |
| Q |
303 |
tgaaaatatcaaaattgcacatgggaagtatatgaagaaagatatagagataaaaagaaatgacctttgct |
373 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5553260 |
tgaaaatatcaaaattgcacataggaagtatatgaagaaagatatagagataaaaagaaatgacctttgct |
5553190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University