View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1390_low_78 (Length: 369)
Name: NF1390_low_78
Description: NF1390
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1390_low_78 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 334; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 334; E-Value: 0
Query Start/End: Original strand, 29 - 366
Target Start/End: Complemental strand, 32875089 - 32874752
Alignment:
| Q |
29 |
agtttggtttgcaaagatatactatttcctagcaaagaatgatagtatgttttctttatatttctgtgcaaagatgttgagaagtttggtgaagtagaag |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32875089 |
agtttggtttgcaaagatatactatttcctagcaaagaatgatagtatgttttctttatatttctgtgcaaagatgttgagaagtttggtgaagtagaag |
32874990 |
T |
 |
| Q |
129 |
cagccattgtttaatttctttgccgctcttgctttatttgaattataaccaagctttaagagataaggtgaatgcagtagcataaaccataaccttacaa |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32874989 |
cagccattgtttaatttctttgccgctcttgctttatttgaattataaccaagctttaagagataaggtgaatgcagtagcataaaccataaccttacaa |
32874890 |
T |
 |
| Q |
229 |
atccaatataacaggaacaaaaaataaatatctctaagatttttgttgttctttttgtctatatgctaattatttttgtcattagttccatgtgatattt |
328 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32874889 |
atccaatataacaggaacaaaaaataaatatctctaagatttttgttgttctttttgtctatatgctaattatttttgtcattagttccatgtgatattt |
32874790 |
T |
 |
| Q |
329 |
ttgtgagtaaaatgtgtgcctggtatattcttggagat |
366 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
32874789 |
ttgtgagtaaaatgtgtgcctggtatattcttgcagat |
32874752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University