View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1390_low_86 (Length: 358)
Name: NF1390_low_86
Description: NF1390
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1390_low_86 |
![](./plan/images/spacer.gif) | ![NF1390_low_86](./plan/images/spacer.gif) |
|
Alignment Details
Target: chr7 (Bit Score: 196; Significance: 1e-106; HSPs: 5)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 196; E-Value: 1e-106
Query Start/End: Original strand, 15 - 263
Target Start/End: Original strand, 46130421 - 46130682
Alignment:
Q |
15 |
actaactcttgaggatcaggttgggaaaagtttgcaaggatagcatgtgcagtaaatttagcatatcctatataat--------------gaatttagaa |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
T |
46130421 |
actaactcttgaggatcaggttgggaaaagtttgcaaggatagcatgtgcagtaaatttagcatatcctatataatttaataaatataatgaatttagaa |
46130520 |
T |
![](./plan/images/spacer.gif) |
Q |
101 |
atggttttgttatccttttcagatcttaccagcattgcctggccttcgggaactcttattgatgcctgatgaattagttttactatatgcatgctctatt |
200 |
Q |
|
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
46130521 |
atggttttgttatt-ttttcagatcttaccagcattgcctggccttcgggaactcttattgatgcctgatgaattagttttactatatgcatgctctatt |
46130619 |
T |
![](./plan/images/spacer.gif) |
Q |
201 |
ctctactggcttactcaggatggttcaggcaaaatggttcaagctatccttgagggaaatttt |
263 |
Q |
|
|
||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
46130620 |
ctctactggattactcgggatggttcaggcaaaatggttcaagctatccttgagggaaatttt |
46130682 |
T |
![](./plan/images/spacer.gif) |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 124; E-Value: 1e-63
Query Start/End: Original strand, 108 - 263
Target Start/End: Original strand, 46703342 - 46703497
Alignment:
Q |
108 |
tgttatccttttcagatcttaccagcattgcctggccttcgggaactcttattgatgcctgatgaattagttttactatatgcatgctctattctctact |
207 |
Q |
|
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||| |
|
|
T |
46703342 |
tgttatccttttcagatcttaccagcattgtctggccttcgggaactcttattgatgcctgatgaatcagttcaactatatgcatgctctattctctact |
46703441 |
T |
![](./plan/images/spacer.gif) |
Q |
208 |
ggcttactcaggatggttcaggcaaaatggttcaagctatccttgagggaaatttt |
263 |
Q |
|
|
|||||||||||||| |||||| | ||||||||||||||||| |||||||||||||| |
|
|
T |
46703442 |
ggcttactcaggattgttcagacgaaatggttcaagctatcgttgagggaaatttt |
46703497 |
T |
![](./plan/images/spacer.gif) |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 108 - 255
Target Start/End: Original strand, 46124551 - 46124698
Alignment:
Q |
108 |
tgttatccttttcagatcttaccagcattgcctggccttcgggaactcttattgatgcctgatgaattagttttactatatgcatgctctattctctact |
207 |
Q |
|
|
||||||| ||||||||| ||||||||||| ||||||||| ||| ||||||||||||||||||||| |||| |||||||||||||| | | |||| || |
|
|
T |
46124551 |
tgttatctttttcagatgctaccagcattgtctggccttcaggagctcttattgatgcctgatgaagaagttatactatatgcatgccatctcctctcct |
46124650 |
T |
![](./plan/images/spacer.gif) |
Q |
208 |
ggcttactcaggatggttcaggcaaaatggttcaagctatccttgagg |
255 |
Q |
|
|
|| |||||||| | ||||||| ||||||||||||||||||| |||||| |
|
|
T |
46124651 |
ggtttactcagaaaggttcagacaaaatggttcaagctatcgttgagg |
46124698 |
T |
![](./plan/images/spacer.gif) |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 16 - 90
Target Start/End: Original strand, 46703203 - 46703277
Alignment:
Q |
16 |
ctaactcttgaggatcaggttgggaaaagtttgcaaggatagcatgtgcagtaaatttagcatatcctatataat |
90 |
Q |
|
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
46703203 |
ctaactcttgaggatcaggttgggaaaactttgcaaggatagcatgtgcagtaaatttagcatatcctatataat |
46703277 |
T |
![](./plan/images/spacer.gif) |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 16 - 89
Target Start/End: Original strand, 46124413 - 46124486
Alignment:
Q |
16 |
ctaactcttgaggatcaggttgggaaaagtttgcaaggatagcatgtgcagtaaatttagcatatcctatataa |
89 |
Q |
|
|
||||||||| || ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
46124413 |
ctaactcttcagaatcaggttgggaaaaatttgcaaggatagcatgtgcagtaaatttagcatatcctatataa |
46124486 |
T |
![](./plan/images/spacer.gif) |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 15491 times since January 2019
Visitors: 1260