View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1390_low_92 (Length: 351)
Name: NF1390_low_92
Description: NF1390
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1390_low_92 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 93; Significance: 3e-45; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 93; E-Value: 3e-45
Query Start/End: Original strand, 189 - 281
Target Start/End: Complemental strand, 1116631 - 1116539
Alignment:
| Q |
189 |
acagcggcggcgtagaagtgtagagtggaggggggtggtggttgagagaggtttgaaaacggagatgacgagtggtaaagccatgatactgat |
281 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1116631 |
acagcggcggcgtagaagtgtagagtggaggggggtggtggttgagagaggtttgaaaacggagatgacgagtggtaaagccatgatactgat |
1116539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 56 - 98
Target Start/End: Complemental strand, 1116767 - 1116725
Alignment:
| Q |
56 |
gagatgaatggttgtgaggcgcagaattgttggagtgtgtagg |
98 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1116767 |
gagatgaatggttgtgaggcgcagaattgttggagtgtgtagg |
1116725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University