View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13911_high_5 (Length: 439)
Name: NF13911_high_5
Description: NF13911
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13911_high_5 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 164; Significance: 2e-87; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 164; E-Value: 2e-87
Query Start/End: Original strand, 19 - 194
Target Start/End: Complemental strand, 16895159 - 16894984
Alignment:
| Q |
19 |
gtctcagagtgtgccgtgatcatgtacatatactacttttccctttggggaagagaaaacattttagacccataatatgtatactgcatgattcaattgg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16895159 |
gtctcagagtgtgccgtgatcatgtacagatactacttttccctttggggaagagaaaacattttagacccataatatgtatactgcatgattcaattgg |
16895060 |
T |
|
| Q |
119 |
gtttaataatttaataaaaatagttacttgttcacctcaaaatcaaataaataaaggtcgggtatgcttttcatca |
194 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16895059 |
gtttaataatttaacaaaaatagttacttgttcacctaaaaatcaaataaataaaggtcgggtatgcttttcatca |
16894984 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 84; E-Value: 9e-40
Query Start/End: Original strand, 281 - 435
Target Start/End: Complemental strand, 16892344 - 16892196
Alignment:
| Q |
281 |
gaaatgaattattttgcataaacataacttaaaaagttacttcctnnnnnnnnnnncttaaatataaaatgaacatggaagaaaatgatagaaaattatt |
380 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
16892344 |
gaaatgaagtattttgcataaacataacttaaaaagttacttcctaaaaaaaaa--cttaaatatagaatgaacatggaagaaaatgatagaaaattatt |
16892247 |
T |
|
| Q |
381 |
cttggttggtaaccctgaattgtgcactgattatacattatacaaatgccctatg |
435 |
Q |
| |
|
|| ||||||||||||||||| ||||||||||||||||||||||||| ||||| |
|
|
| T |
16892246 |
ct----tggtaaccctgaattgtacactgattatacattatacaaatgctctatg |
16892196 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University