View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13911_high_9 (Length: 279)
Name: NF13911_high_9
Description: NF13911
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13911_high_9 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 149; Significance: 9e-79; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 149; E-Value: 9e-79
Query Start/End: Original strand, 62 - 279
Target Start/End: Complemental strand, 7869342 - 7869126
Alignment:
| Q |
62 |
gacaatactcacttactccttctgttggcgaggccattctttgcaaaaaagtgagttacgatattgtatgaattcacaactaatctcacctataataatt |
161 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||| | ||||||||||||||| |||||||||||||| |||||||||||||||||| |
|
|
| T |
7869342 |
gacaatactcactcactccttctgttggcgaggccattctttgcaaaagaatgagttacgatattgcatgaattcacaactgatctcacctataataatt |
7869243 |
T |
 |
| Q |
162 |
aagtggacattgaaatgtgtttacgtgatggcgaagaacannnnnnnncatgcaaaaacgacgacatttaacccatatttgacaattaagaaggggaagc |
261 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||| | ||||| |||||||||||||||||||||||| | ||||||||||||||||||| |
|
|
| T |
7869242 |
aagtgggcattgaaatgtgtttacgtgatggcgaagaata-tttttttcatgcgaaaacgacgacatttaacccatatctaacaattaagaaggggaagc |
7869144 |
T |
 |
| Q |
262 |
tttcgatctttgtcgagc |
279 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
7869143 |
tttcgatctttgtcgagc |
7869126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University