View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13911_low_13 (Length: 238)
Name: NF13911_low_13
Description: NF13911
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13911_low_13 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 79; Significance: 5e-37; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 20 - 140
Target Start/End: Complemental strand, 7869092 - 7868979
Alignment:
| Q |
20 |
aagaagctttcgatctttgtcgagctattcattggatcagtaggttctattttgacaacataatctttgagttggctacggtgtttgatatttgatagtt |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||| | |||||||||| |
|
|
| T |
7869092 |
aagaagctttcgatctttgtcgagctattcattggatcggtaggttctattttaacaacataatctttgagttggctacggcg-------tttgatagtt |
7869000 |
T |
|
| Q |
120 |
ttcatctgaataaaaaagaca |
140 |
Q |
| |
|
||||||| ||||||||||||| |
|
|
| T |
7868999 |
ttcatctaaataaaaaagaca |
7868979 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 22 - 72
Target Start/End: Complemental strand, 7869148 - 7869098
Alignment:
| Q |
22 |
gaagctttcgatctttgtcgagctattcattggatcagtaggttctatttt |
72 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||| |||| |
|
|
| T |
7869148 |
gaagctttcgatctttgtcgagctattcattggattggtaggttctttttt |
7869098 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University