View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13911_low_13 (Length: 238)

Name: NF13911_low_13
Description: NF13911
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13911_low_13
NF13911_low_13
[»] chr5 (2 HSPs)
chr5 (20-140)||(7868979-7869092)
chr5 (22-72)||(7869098-7869148)


Alignment Details
Target: chr5 (Bit Score: 79; Significance: 5e-37; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 20 - 140
Target Start/End: Complemental strand, 7869092 - 7868979
Alignment:
20 aagaagctttcgatctttgtcgagctattcattggatcagtaggttctattttgacaacataatctttgagttggctacggtgtttgatatttgatagtt 119  Q
    |||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||| |       ||||||||||    
7869092 aagaagctttcgatctttgtcgagctattcattggatcggtaggttctattttaacaacataatctttgagttggctacggcg-------tttgatagtt 7869000  T
120 ttcatctgaataaaaaagaca 140  Q
    ||||||| |||||||||||||    
7868999 ttcatctaaataaaaaagaca 7868979  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 22 - 72
Target Start/End: Complemental strand, 7869148 - 7869098
Alignment:
22 gaagctttcgatctttgtcgagctattcattggatcagtaggttctatttt 72  Q
    |||||||||||||||||||||||||||||||||||  ||||||||| ||||    
7869148 gaagctttcgatctttgtcgagctattcattggattggtaggttctttttt 7869098  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University