View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13912_high_12 (Length: 476)
Name: NF13912_high_12
Description: NF13912
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13912_high_12 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 165; Significance: 5e-88; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 165; E-Value: 5e-88
Query Start/End: Original strand, 24 - 188
Target Start/End: Complemental strand, 11612338 - 11612174
Alignment:
| Q |
24 |
atcaaaactcaagagggtattctgaattgtgaattgtgattgtgataaagtggttcatattcttcatgaatttgtggtggaagctagtgtgaaagttgaa |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11612338 |
atcaaaactcaagagggtattctgaattgtgaattgtgattgtgataaagtggttcatattcttcatgaatttgtggtggaagctagtgtgaaagttgaa |
11612239 |
T |
 |
| Q |
124 |
aaatgttcaacggtttcatatggggaattaaagagagatgatggtgggtgacagaagagcacaga |
188 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11612238 |
aaatgttcaacggtttcatatggggaattaaagagagatgatggtgggtgacagaagagcacaga |
11612174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 101; E-Value: 7e-50
Query Start/End: Original strand, 300 - 455
Target Start/End: Complemental strand, 11612061 - 11611905
Alignment:
| Q |
300 |
catgaatgttgaatagtgttttgctatgctatgtttgttgtgagtgtctgnnnnnnnctctttcttaatatgtgtgtgtgtcagttgcataagtcattat |
399 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11612061 |
catgaatgttgaatagtgttttgctatgctatgtttgttgtgagtgtctgtttttttctctttcttaatatgtgtgtgtgtcagttgcataagtcattat |
11611962 |
T |
 |
| Q |
400 |
caagattgcataa-nnnnnnnnnatctagggatgagggtccttgtttagtttgaata |
455 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
11611961 |
caagattgcataattttttttttatctagggatgagggtccttgtttagtttgaata |
11611905 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University