View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13912_high_23 (Length: 387)
Name: NF13912_high_23
Description: NF13912
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13912_high_23 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 137; Significance: 2e-71; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 137; E-Value: 2e-71
Query Start/End: Original strand, 24 - 164
Target Start/End: Original strand, 11612380 - 11612520
Alignment:
| Q |
24 |
tcatatgttagtactctcttctcttttttcatgtgtccctattgattcatagcactatctctttatttcttatgctttactatgctttgaggtgtgaaat |
123 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11612380 |
tcatatgttagtactctcttctcttttttcatgtgtcactattgattcatagcactatctctttatttcttatgctttactatgctttgaggtgtgaaat |
11612479 |
T |
|
| Q |
124 |
atcttttactgcttttcacttaattcaccaaagttcttacc |
164 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11612480 |
atcttttactgcttttcacttaattcaccaaagttcttacc |
11612520 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 69; E-Value: 7e-31
Query Start/End: Original strand, 290 - 370
Target Start/End: Original strand, 11612646 - 11612726
Alignment:
| Q |
290 |
agtgtatttatcaaaggataagcttacaagggttatcttagaaattgcttaatgttaaagattttgttatggttggttggt |
370 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11612646 |
agtgtatttatcaaaggataagcttaaaagggttacattagaaattgcttaatgttaaagattttgttatggttggttggt |
11612726 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University