View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13912_high_40 (Length: 246)
Name: NF13912_high_40
Description: NF13912
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13912_high_40 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 18 - 244
Target Start/End: Original strand, 39261952 - 39262178
Alignment:
| Q |
18 |
atatgtcgcagaccatattcaacttacatatagctactacaagggtatatatagtaacatatttccaagcaaactaagcatctgtgtcatcaacaaccac |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39261952 |
atatgtcgcagaccatattcaacttacatatagctactacaagggtatatatagtaacatatttccaagcaaactaagcatctgtgtcatcaacaaccac |
39262051 |
T |
 |
| Q |
118 |
tttgtatgtgaccttactaagcctgcttggtgataatgtcttggaatcattgcctctagtttttctgcttccactgcgttgaaaaccactagaaccgtac |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39262052 |
tttgtatgtgaccttactaagcctgcttggtgataatgtcttggaatcattgcctctagtttttctgcttccactgcgttgaaaaccactagaaccgtac |
39262151 |
T |
 |
| Q |
218 |
actgctctgaatgcctatgcttctcca |
244 |
Q |
| |
|
||||||||||||||| |||||| |||| |
|
|
| T |
39262152 |
actgctctgaatgccaatgcttttcca |
39262178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University