View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13912_high_42 (Length: 237)
Name: NF13912_high_42
Description: NF13912
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13912_high_42 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 63 - 221
Target Start/End: Original strand, 29519043 - 29519201
Alignment:
| Q |
63 |
tatattatatctaagctagaatataaggtcataatataacacttatcaatgttgttgtagtgaccactcttttctacatgtaaatatggtcaaatggcga |
162 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
29519043 |
tatattatatctaagctagaatataaggtcataatataacacttatcaatgttgttgtagtgatcactcttttctacatgtaaatatggtcaaatggcga |
29519142 |
T |
 |
| Q |
163 |
atatgctcactatgtcacacctagattatttgtgagataaattatttctctcatattca |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29519143 |
atatgctcactatgtcacacctagattatttgtgagataaattatttctctcatattca |
29519201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 60
Target Start/End: Complemental strand, 2912958 - 2912899
Alignment:
| Q |
1 |
agtcagttaggtcaaaattnnnnnnnttctaaatgggtcacttattaagggacggaggga |
60 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
2912958 |
agtcagttaggtcaaaattaaaaaaattctaaatgggtcacttattaagggacggaggga |
2912899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 1 - 60
Target Start/End: Complemental strand, 29708622 - 29708563
Alignment:
| Q |
1 |
agtcagttaggtcaaaattnnnnnnnttctaaatgggtcacttattaagggacggaggga |
60 |
Q |
| |
|
||||||||||||||||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
29708622 |
agtcagttaggtcaaaattaaaaaaattccaaatgggtcacttattaagggacggaggga |
29708563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 1 - 60
Target Start/End: Original strand, 30352074 - 30352133
Alignment:
| Q |
1 |
agtcagttaggtcaaaattnnnnnnnttctaaatgggtcacttattaagggacggaggga |
60 |
Q |
| |
|
||||||||||||||||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
30352074 |
agtcagttaggtcaaaattaaaaaaattccaaatgggtcacttattaagggacggaggga |
30352133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University