View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13912_low_12 (Length: 479)

Name: NF13912_low_12
Description: NF13912
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13912_low_12
NF13912_low_12
[»] chr4 (1 HSPs)
chr4 (14-101)||(5313304-5313390)


Alignment Details
Target: chr4 (Bit Score: 72; Significance: 1e-32; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 14 - 101
Target Start/End: Original strand, 5313304 - 5313390
Alignment:
14 atcatccctatattcaaaagtgtttcgatatcatggagtattttattcaaaacattctatactaagttttacattttaacaagtacac 101  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||| |||||    
5313304 atcatccctatattcaaaagtgtttcgatatcatggagtattttattcaaaacattctacact-agttttacattttaacaaatacac 5313390  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University