View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13912_low_21 (Length: 420)

Name: NF13912_low_21
Description: NF13912
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13912_low_21
NF13912_low_21
[»] chr4 (115 HSPs)
chr4 (36-420)||(14983791-14984175)
chr4 (32-215)||(5648212-5648394)
chr4 (31-213)||(6430627-6430808)
chr4 (33-211)||(21646918-21647098)
chr4 (30-214)||(20224935-20225117)
chr4 (36-217)||(16911519-16911702)
chr4 (32-215)||(48598824-48599005)
chr4 (32-215)||(30639333-30639515)
chr4 (33-215)||(47528529-47528709)
chr4 (32-215)||(5306659-5306845)
chr4 (40-215)||(16408600-16408777)
chr4 (33-215)||(23501747-23501925)
chr4 (33-198)||(37494805-37494970)
chr4 (52-198)||(40915802-40915947)
chr4 (52-214)||(44363130-44363294)
chr4 (33-215)||(11054147-11054327)
chr4 (33-195)||(10660358-10660521)
chr4 (33-195)||(10874503-10874666)
chr4 (59-195)||(17043413-17043549)
chr4 (96-215)||(20639657-20639777)
chr4 (30-198)||(54730200-54730371)
chr4 (34-194)||(54966977-54967135)
chr4 (33-215)||(13256398-13256578)
chr4 (57-214)||(30690176-30690340)
chr4 (62-191)||(7385499-7385628)
chr4 (65-194)||(25463108-25463237)
chr4 (90-215)||(47443968-47444093)
chr4 (103-215)||(25629073-25629185)
chr4 (55-215)||(35567146-35567306)
chr4 (57-215)||(9832312-9832468)
chr4 (55-196)||(39029078-39029220)
chr4 (54-198)||(19027823-19027967)
chr4 (33-215)||(20908635-20908818)
chr4 (103-195)||(51865057-51865149)
chr4 (33-198)||(20405047-20405208)
chr4 (58-198)||(30496338-30496476)
chr4 (91-195)||(9987853-9987957)
chr4 (38-215)||(30352579-30352767)
chr4 (60-215)||(39077795-39077948)
chr4 (90-212)||(29207900-29208020)
chr4 (59-215)||(54175043-54175201)
chr4 (97-198)||(7909296-7909397)
chr4 (50-213)||(8473621-8473784)
chr4 (32-162)||(14590790-14590921)
chr4 (55-194)||(47441550-47441689)
chr4 (67-216)||(7038041-7038189)
chr4 (33-198)||(55766482-55766647)
chr4 (33-214)||(55830721-55830902)
chr4 (57-194)||(32478811-32478942)
chr4 (58-196)||(49938611-49938746)
chr4 (91-194)||(21489099-21489203)
chr4 (103-193)||(49796822-49796911)
chr4 (308-368)||(7246316-7246376)
chr4 (62-198)||(41018810-41018945)
chr4 (54-149)||(25343162-25343257)
chr4 (57-198)||(30581481-30581624)
chr4 (55-153)||(487196-487294)
chr4 (157-215)||(36816383-36816441)
chr4 (152-214)||(38755908-38755970)
chr4 (143-215)||(38786673-38786745)
chr4 (151-214)||(11394924-11394987)
chr4 (151-214)||(11404651-11404714)
chr4 (36-123)||(17315389-17315476)
chr4 (126-214)||(20225121-20225211)
chr4 (152-215)||(33836486-33836549)
chr4 (164-215)||(35532077-35532128)
chr4 (164-219)||(40553932-40553987)
chr4 (157-215)||(32484311-32484369)
chr4 (64-201)||(32629282-32629418)
chr4 (308-354)||(41083113-41083159)
chr4 (56-194)||(3580860-3580994)
chr4 (308-368)||(25056188-25056248)
chr4 (308-368)||(41083346-41083406)
chr4 (308-355)||(41083052-41083099)
chr4 (151-194)||(47482870-47482913)
chr4 (308-354)||(7246051-7246097)
chr4 (90-215)||(10277756-10277879)
chr4 (152-214)||(25388249-25388311)
chr4 (308-354)||(45038408-45038454)
chr4 (36-109)||(5313099-5313172)
chr4 (308-353)||(26782353-26782398)
chr4 (90-194)||(36589754-36589859)
chr4 (308-368)||(17231973-17232033)
chr4 (36-76)||(18969698-18969738)
chr4 (308-368)||(26782525-26782585)
chr4 (55-123)||(42164239-42164307)
chr4 (308-368)||(45038174-45038234)
chr4 (308-368)||(45787008-45787068)
chr4 (308-352)||(55617583-55617627)
chr4 (308-352)||(55624887-55624931)
chr4 (111-213)||(12711450-12711553)
chr4 (1-32)||(14983673-14983704)
chr4 (308-355)||(24684337-24684384)
chr4 (32-83)||(29879628-29879679)
chr4 (307-350)||(41083285-41083328)
chr4 (308-355)||(41519445-41519492)
chr4 (55-134)||(43035224-43035303)
chr4 (157-196)||(44718645-44718684)
chr4 (321-368)||(51950784-51950831)
chr4 (308-354)||(2470140-2470186)
chr4 (308-350)||(9999522-9999564)
chr4 (157-215)||(19027989-19028047)
chr4 (308-354)||(21322062-21322108)
chr4 (165-203)||(37038134-37038172)
chr4 (308-354)||(40395158-40395204)
chr4 (308-354)||(46196169-46196215)
chr4 (308-353)||(45038468-45038513)
chr4 (55-124)||(54640429-54640498)
chr4 (308-368)||(2470200-2470260)
chr4 (308-368)||(7245977-7246037)
chr4 (70-154)||(10380003-10380086)
chr4 (310-354)||(12592424-12592468)
chr4 (121-202)||(16494259-16494342)
chr4 (57-129)||(23580293-23580365)
chr4 (308-368)||(53863611-53863671)
[»] chr8 (71 HSPs)
chr8 (30-218)||(36720747-36720935)
chr8 (33-215)||(35261633-35261815)
chr8 (30-215)||(28817625-28817810)
chr8 (33-217)||(44530103-44530287)
chr8 (32-198)||(13160655-13160820)
chr8 (32-215)||(25250475-25250660)
chr8 (32-217)||(39460991-39461178)
chr8 (33-215)||(12670249-12670429)
chr8 (33-198)||(29521701-29521866)
chr8 (31-215)||(30454096-30454278)
chr8 (32-215)||(6760776-6760960)
chr8 (33-215)||(7136526-7136710)
chr8 (46-215)||(8897763-8897932)
chr8 (31-215)||(18164759-18164942)
chr8 (32-214)||(2626472-2626657)
chr8 (33-213)||(45071219-45071398)
chr8 (50-216)||(12625860-12626027)
chr8 (30-214)||(17823527-17823711)
chr8 (24-198)||(20284085-20284263)
chr8 (56-194)||(24365079-24365218)
chr8 (33-216)||(26954086-26954272)
chr8 (24-198)||(21070713-21070892)
chr8 (90-194)||(5135309-5135413)
chr8 (96-212)||(29877111-29877227)
chr8 (33-191)||(20869523-20869677)
chr8 (90-198)||(389654-389764)
chr8 (50-214)||(28407387-28407538)
chr8 (90-196)||(8483956-8484062)
chr8 (55-198)||(44781520-44781665)
chr8 (32-216)||(40604904-40605087)
chr8 (97-215)||(20869941-20870061)
chr8 (90-198)||(5689642-5689750)
chr8 (61-217)||(31457155-31457310)
chr8 (55-203)||(22598133-22598280)
chr8 (55-198)||(42083714-42083858)
chr8 (103-215)||(10857852-10857965)
chr8 (89-198)||(17250891-17251002)
chr8 (310-369)||(24827341-24827400)
chr8 (140-215)||(26102578-26102653)
chr8 (105-198)||(16225045-16225140)
chr8 (58-130)||(30962857-30962929)
chr8 (308-368)||(41151390-41151450)
chr8 (94-173)||(23000260-23000338)
chr8 (121-219)||(19729382-19729480)
chr8 (33-195)||(24245405-24245565)
chr8 (165-215)||(27468091-27468141)
chr8 (90-198)||(44742534-44742643)
chr8 (90-193)||(14017989-14018093)
chr8 (58-177)||(35105902-35106022)
chr8 (157-198)||(27507988-27508029)
chr8 (150-215)||(35107310-35107375)
chr8 (308-368)||(6220168-6220228)
chr8 (311-355)||(9399814-9399858)
chr8 (308-368)||(9400119-9400179)
chr8 (32-76)||(23286431-23286475)
chr8 (308-356)||(27052405-27052453)
chr8 (50-133)||(11748270-11748353)
chr8 (135-215)||(16013510-16013592)
chr8 (151-198)||(18595910-18595957)
chr8 (308-355)||(24909696-24909743)
chr8 (116-159)||(28873235-28873278)
chr8 (80-195)||(36918125-36918240)
chr8 (312-367)||(42667432-42667487)
chr8 (308-354)||(6220475-6220521)
chr8 (308-354)||(24827416-24827462)
chr8 (308-354)||(27052626-27052672)
chr8 (308-357)||(27127874-27127922)
chr8 (308-361)||(27128168-27128220)
chr8 (123-198)||(26457773-26457846)
chr8 (170-214)||(30962771-30962815)
chr8 (35-107)||(31454144-31454216)
[»] chr5 (76 HSPs)
chr5 (33-215)||(24448844-24449026)
chr5 (32-216)||(38879534-38879720)
chr5 (32-216)||(41014272-41014455)
chr5 (36-218)||(4619100-4619284)
chr5 (33-215)||(35710267-35710447)
chr5 (36-215)||(43334159-43334340)
chr5 (36-195)||(27328709-27328870)
chr5 (33-215)||(8169983-8170163)
chr5 (54-198)||(19142959-19143102)
chr5 (66-216)||(32703411-32703559)
chr5 (101-214)||(7097760-7097872)
chr5 (62-197)||(1405170-1405305)
chr5 (31-194)||(22600406-22600569)
chr5 (89-196)||(43574616-43574723)
chr5 (55-198)||(208943-209086)
chr5 (30-134)||(23974732-23974835)
chr5 (50-213)||(12006329-12006494)
chr5 (90-214)||(13801767-13801893)
chr5 (33-214)||(1565385-1565566)
chr5 (104-198)||(16880663-16880757)
chr5 (55-215)||(28516432-28516593)
chr5 (30-122)||(37024646-37024738)
chr5 (56-203)||(31694119-31694266)
chr5 (34-191)||(2838733-2838890)
chr5 (50-219)||(30006296-30006464)
chr5 (140-216)||(16957375-16957451)
chr5 (94-211)||(7368413-7368528)
chr5 (31-214)||(22187237-22187422)
chr5 (90-198)||(42924846-42924958)
chr5 (94-198)||(5873338-5873441)
chr5 (36-217)||(22861666-22861844)
chr5 (98-213)||(20135623-20135740)
chr5 (103-216)||(29334419-29334533)
chr5 (57-194)||(24323725-24323862)
chr5 (57-194)||(24360349-24360486)
chr5 (93-194)||(24903716-24903817)
chr5 (59-192)||(34074584-34074717)
chr5 (126-214)||(34154814-34154902)
chr5 (308-372)||(28559216-28559280)
chr5 (55-190)||(39301099-39301235)
chr5 (63-198)||(1850624-1850758)
chr5 (97-194)||(12575680-12575779)
chr5 (152-198)||(25622533-25622579)
chr5 (151-195)||(10306493-10306537)
chr5 (312-368)||(10827402-10827458)
chr5 (308-368)||(17400839-17400899)
chr5 (90-134)||(22025554-22025598)
chr5 (164-216)||(32354212-32354264)
chr5 (308-368)||(35461421-35461481)
chr5 (90-186)||(41425959-41426055)
chr5 (157-215)||(16028623-16028681)
chr5 (308-354)||(16327157-16327203)
chr5 (308-354)||(25456334-25456380)
chr5 (50-116)||(31299603-31299669)
chr5 (119-216)||(3771379-3771476)
chr5 (85-198)||(18426045-18426158)
chr5 (33-78)||(19438703-19438748)
chr5 (308-368)||(16327083-16327143)
chr5 (310-354)||(19550312-19550356)
chr5 (151-211)||(21784335-21784395)
chr5 (90-162)||(22907917-22907988)
chr5 (308-368)||(35461728-35461788)
chr5 (308-355)||(19550359-19550406)
chr5 (157-216)||(39801594-39801653)
chr5 (308-354)||(12713119-12713165)
chr5 (308-354)||(12774383-12774429)
chr5 (164-198)||(13774950-13774984)
chr5 (308-354)||(16327331-16327377)
chr5 (316-358)||(28559536-28559578)
chr5 (315-376)||(6588140-6588200)
chr5 (151-192)||(21542489-21542530)
chr5 (157-214)||(30877564-30877621)
chr5 (308-352)||(23662171-23662215)
chr5 (308-352)||(23796373-23796417)
chr5 (157-213)||(29184062-29184118)
chr5 (308-368)||(32361153-32361213)
[»] chr2 (83 HSPs)
chr2 (33-217)||(8455313-8455497)
chr2 (30-214)||(14530269-14530455)
chr2 (34-214)||(10543653-10543835)
chr2 (32-218)||(21779257-21779441)
chr2 (35-217)||(11514392-11514573)
chr2 (33-216)||(9671134-9671316)
chr2 (31-214)||(25079717-25079901)
chr2 (33-216)||(5840982-5841167)
chr2 (33-183)||(12023950-12024099)
chr2 (48-215)||(17667971-17668138)
chr2 (32-214)||(23397719-23397899)
chr2 (70-215)||(14444720-14444864)
chr2 (35-203)||(19977725-19977893)
chr2 (34-215)||(24200622-24200805)
chr2 (36-215)||(25249737-25249915)
chr2 (46-215)||(17623531-17623700)
chr2 (35-215)||(17896215-17896396)
chr2 (32-183)||(22371010-22371158)
chr2 (33-195)||(26684639-26684803)
chr2 (55-202)||(4516363-4516510)
chr2 (90-215)||(10546173-10546299)
chr2 (33-215)||(7214488-7214672)
chr2 (34-214)||(14544018-14544201)
chr2 (53-216)||(39914304-39914467)
chr2 (33-149)||(17705449-17705565)
chr2 (95-215)||(36871509-36871627)
chr2 (54-214)||(40416871-40417031)
chr2 (55-194)||(21377093-21377232)
chr2 (57-197)||(31158456-31158598)
chr2 (103-214)||(40762234-40762345)
chr2 (56-201)||(99278-99421)
chr2 (94-203)||(30826052-30826159)
chr2 (90-194)||(32781308-32781412)
chr2 (56-211)||(45235820-45235976)
chr2 (59-194)||(17380257-17380391)
chr2 (64-198)||(25641487-25641620)
chr2 (114-195)||(31821362-31821443)
chr2 (50-198)||(24860004-24860150)
chr2 (114-214)||(25632544-25632644)
chr2 (39-215)||(27573581-27573756)
chr2 (51-123)||(44604826-44604898)
chr2 (54-216)||(44643497-44643660)
chr2 (57-177)||(5450263-5450384)
chr2 (55-176)||(23145736-23145857)
chr2 (55-176)||(23557526-23557647)
chr2 (55-194)||(33795261-33795400)
chr2 (308-368)||(33847725-33847785)
chr2 (312-367)||(5009468-5009523)
chr2 (119-198)||(24890451-24890530)
chr2 (128-213)||(13245096-13245181)
chr2 (151-219)||(23488555-23488623)
chr2 (159-214)||(8575975-8576030)
chr2 (166-217)||(22371199-22371250)
chr2 (55-133)||(29419970-29420048)
chr2 (31-77)||(39189558-39189604)
chr2 (68-204)||(19614981-19615118)
chr2 (157-198)||(34766333-34766374)
chr2 (157-217)||(34080179-34080239)
chr2 (157-213)||(40579750-40579806)
chr2 (90-215)||(15296405-15296531)
chr2 (143-201)||(24059009-24059067)
chr2 (308-354)||(25895208-25895254)
chr2 (144-202)||(31525771-31525829)
chr2 (103-198)||(17471572-17471669)
chr2 (312-369)||(44556509-44556566)
chr2 (166-198)||(124930-124962)
chr2 (308-368)||(4189045-4189105)
chr2 (308-368)||(9500890-9500950)
chr2 (308-368)||(14166479-14166539)
chr2 (55-195)||(44521392-44521532)
chr2 (151-198)||(4794874-4794921)
chr2 (308-351)||(5009405-5009448)
chr2 (308-355)||(25894963-25895010)
chr2 (94-193)||(30864438-30864536)
chr2 (120-203)||(39499241-39499324)
chr2 (157-212)||(41409940-41409995)
chr2 (308-355)||(43699471-43699518)
chr2 (164-214)||(3633708-3633758)
chr2 (151-197)||(19185760-19185806)
chr2 (308-353)||(29379925-29379970)
chr2 (56-124)||(4795730-4795798)
chr2 (33-77)||(27466267-27466311)
chr2 (55-110)||(35017793-35017849)
[»] chr3 (98 HSPs)
chr3 (32-215)||(40272811-40272994)
chr3 (32-195)||(8247706-8247871)
chr3 (32-217)||(13628787-13628975)
chr3 (32-214)||(39203491-39203671)
chr3 (33-215)||(13730601-13730785)
chr3 (33-195)||(46421054-46421218)
chr3 (34-216)||(29366718-29366902)
chr3 (33-216)||(12914033-12914216)
chr3 (44-215)||(26869694-26869864)
chr3 (33-215)||(52926218-52926391)
chr3 (32-215)||(1217065-1217246)
chr3 (31-213)||(22609741-22609921)
chr3 (31-217)||(16735415-16735600)
chr3 (33-198)||(6411838-6412002)
chr3 (55-212)||(26573125-26573282)
chr3 (33-162)||(4495716-4495845)
chr3 (32-197)||(9607178-9607345)
chr3 (56-198)||(34420659-34420802)
chr3 (30-215)||(5173718-5173905)
chr3 (37-213)||(22122918-22123092)
chr3 (90-214)||(31592882-31593004)
chr3 (90-198)||(45948854-45948962)
chr3 (90-214)||(10795423-10795549)
chr3 (97-215)||(54484730-54484849)
chr3 (31-155)||(7696946-7697068)
chr3 (55-215)||(53996564-53996725)
chr3 (65-215)||(516417-516570)
chr3 (34-216)||(25517168-25517353)
chr3 (80-197)||(54374362-54374480)
chr3 (90-198)||(14986990-14987100)
chr3 (59-194)||(30928167-30928302)
chr3 (102-214)||(45786214-45786328)
chr3 (60-198)||(7942993-7943131)
chr3 (33-123)||(10870042-10870132)
chr3 (103-215)||(49013472-49013586)
chr3 (56-215)||(25944468-25944628)
chr3 (90-198)||(43114884-43114994)
chr3 (106-215)||(15797271-15797378)
chr3 (55-200)||(28904941-28905086)
chr3 (53-213)||(33235526-33235687)
chr3 (106-195)||(9276313-9276401)
chr3 (68-216)||(54032569-54032705)
chr3 (121-215)||(34771363-34771457)
chr3 (32-215)||(12525385-12525565)
chr3 (93-198)||(19731038-19731143)
chr3 (90-198)||(33926116-33926224)
chr3 (102-183)||(47624087-47624167)
chr3 (90-194)||(55401209-55401314)
chr3 (115-212)||(353351-353450)
chr3 (55-198)||(44403571-44403715)
chr3 (103-215)||(50624952-50625064)
chr3 (55-131)||(53062036-53062112)
chr3 (55-149)||(45620893-45620988)
chr3 (151-201)||(10300585-10300635)
chr3 (159-217)||(10484613-10484671)
chr3 (90-198)||(829458-829567)
chr3 (36-159)||(21874999-21875116)
chr3 (93-154)||(29106585-29106646)
chr3 (68-194)||(45139497-45139624)
chr3 (166-215)||(47624208-47624257)
chr3 (151-215)||(24851300-24851364)
chr3 (157-217)||(30452895-30452955)
chr3 (308-368)||(39541461-39541521)
chr3 (308-368)||(47573680-47573740)
chr3 (140-215)||(24578008-24578083)
chr3 (308-367)||(26976528-26976587)
chr3 (308-367)||(28814090-28814149)
chr3 (308-355)||(47069526-47069573)
chr3 (96-213)||(31904857-31904975)
chr3 (308-354)||(32186705-32186751)
chr3 (55-129)||(35417914-35417988)
chr3 (308-354)||(40286479-40286525)
chr3 (308-354)||(50332725-50332771)
chr3 (308-353)||(13903036-13903081)
chr3 (93-198)||(19751614-19751719)
chr3 (171-215)||(4495675-4495719)
chr3 (308-368)||(32186448-32186507)
chr3 (308-356)||(45131436-45131484)
chr3 (308-368)||(47891412-47891472)
chr3 (312-367)||(3377014-3377069)
chr3 (308-350)||(7607718-7607759)
chr3 (308-354)||(14964889-14964934)
chr3 (308-358)||(26976371-26976421)
chr3 (308-354)||(40286297-40286343)
chr3 (173-215)||(40390357-40390399)
chr3 (313-355)||(47069766-47069808)
chr3 (308-354)||(47891352-47891398)
chr3 (107-215)||(26292382-26292488)
chr3 (36-157)||(26782345-26782466)
chr3 (103-155)||(31831245-31831295)
chr3 (315-367)||(3382500-3382552)
chr3 (322-354)||(5442124-5442156)
chr3 (32-72)||(9276249-9276289)
chr3 (308-368)||(21696600-21696659)
chr3 (308-368)||(25848272-25848332)
chr3 (96-203)||(31672732-31672840)
chr3 (165-213)||(45288056-45288104)
chr3 (106-154)||(52428537-52428585)
[»] scaffold0057 (4 HSPs)
scaffold0057 (54-215)||(46806-46967)
scaffold0057 (32-215)||(24771-24949)
scaffold0057 (92-217)||(43672-43796)
scaffold0057 (126-195)||(46726-46796)
[»] chr1 (94 HSPs)
chr1 (33-215)||(46247952-46248134)
chr1 (36-198)||(23768336-23768498)
chr1 (32-217)||(34725095-34725278)
chr1 (33-215)||(18944620-18944805)
chr1 (32-216)||(14617014-14617198)
chr1 (39-219)||(30395721-30395903)
chr1 (33-211)||(46991781-46991959)
chr1 (31-216)||(41319804-41319989)
chr1 (52-215)||(6925096-6925259)
chr1 (33-218)||(10668197-10668389)
chr1 (32-217)||(27474257-27474441)
chr1 (33-218)||(32632553-32632737)
chr1 (33-218)||(20004086-20004273)
chr1 (33-215)||(45812536-45812716)
chr1 (33-203)||(47214488-47214656)
chr1 (55-194)||(18724565-18724704)
chr1 (33-215)||(38478281-38478461)
chr1 (32-198)||(27201623-27201791)
chr1 (90-216)||(35005157-35005285)
chr1 (32-215)||(8197019-8197202)
chr1 (38-211)||(45402077-45402251)
chr1 (54-218)||(6983807-6983969)
chr1 (56-192)||(25468285-25468421)
chr1 (55-198)||(35117781-35117927)
chr1 (33-179)||(22930104-22930248)
chr1 (117-214)||(4349699-4349796)
chr1 (55-198)||(2435802-2435946)
chr1 (37-216)||(19414420-19414597)
chr1 (56-203)||(19701570-19701718)
chr1 (58-216)||(9939463-9939624)
chr1 (97-215)||(31382213-31382330)
chr1 (90-215)||(35253186-35253309)
chr1 (39-215)||(12126836-12127010)
chr1 (32-217)||(19932750-19932934)
chr1 (54-190)||(20036218-20036355)
chr1 (37-197)||(18335305-18335465)
chr1 (55-194)||(11596512-11596650)
chr1 (54-198)||(15511164-15511311)
chr1 (53-160)||(4430080-4430187)
chr1 (38-215)||(18741956-18742137)
chr1 (56-194)||(44485129-44485267)
chr1 (98-215)||(23796507-23796624)
chr1 (36-134)||(25290143-25290243)
chr1 (96-199)||(20169104-20169207)
chr1 (46-192)||(27136673-27136819)
chr1 (55-198)||(35019229-35019371)
chr1 (80-198)||(45264415-45264534)
chr1 (50-144)||(14987989-14988083)
chr1 (34-120)||(21723642-21723727)
chr1 (120-215)||(42304206-42304303)
chr1 (55-195)||(50811938-50812079)
chr1 (90-198)||(19974090-19974198)
chr1 (107-216)||(20999848-20999957)
chr1 (98-191)||(34148983-34149076)
chr1 (56-198)||(39214974-39215117)
chr1 (55-149)||(17470411-17470505)
chr1 (55-149)||(50760291-50760385)
chr1 (33-162)||(10163736-10163865)
chr1 (121-198)||(10378751-10378828)
chr1 (90-212)||(22324927-22325049)
chr1 (54-119)||(25554817-25554882)
chr1 (35-100)||(40424721-40424786)
chr1 (126-195)||(43768209-43768278)
chr1 (108-215)||(1517310-1517418)
chr1 (126-194)||(15505634-15505702)
chr1 (58-134)||(22327101-22327177)
chr1 (308-368)||(26879693-26879753)
chr1 (90-194)||(30682848-30682950)
chr1 (151-215)||(50606498-50606562)
chr1 (120-191)||(21910673-21910743)
chr1 (50-149)||(33222978-33223076)
chr1 (308-354)||(34173317-34173363)
chr1 (107-191)||(20982773-20982858)
chr1 (34-155)||(24564322-24564443)
chr1 (31-108)||(34714598-34714675)
chr1 (90-198)||(23371158-23371264)
chr1 (308-368)||(33650383-33650443)
chr1 (55-126)||(2435981-2436052)
chr1 (162-217)||(19386573-19386628)
chr1 (90-194)||(31442409-31442515)
chr1 (66-198)||(31272397-31272522)
chr1 (157-198)||(33594147-33594188)
chr1 (311-368)||(33650696-33650753)
chr1 (55-124)||(52910216-52910285)
chr1 (34-146)||(18335914-18336026)
chr1 (150-198)||(30555209-30555257)
chr1 (308-368)||(40892591-40892651)
chr1 (151-198)||(4587579-4587626)
chr1 (308-367)||(52913017-52913076)
chr1 (308-354)||(2633555-2633601)
chr1 (50-120)||(22151498-22151568)
chr1 (55-133)||(34679300-34679378)
chr1 (103-184)||(21723731-21723811)
chr1 (159-215)||(16120819-16120875)
[»] chr7 (91 HSPs)
chr7 (31-198)||(2541035-2541203)
chr7 (30-215)||(32758212-32758395)
chr7 (32-215)||(42805477-42805662)
chr7 (40-213)||(11617589-11617762)
chr7 (33-216)||(21172007-21172188)
chr7 (33-214)||(47716413-47716596)
chr7 (33-215)||(42798623-42798805)
chr7 (32-197)||(34626225-34626389)
chr7 (41-215)||(27629596-27629770)
chr7 (50-215)||(19426889-19427053)
chr7 (32-214)||(48735122-48735303)
chr7 (40-198)||(10693089-10693245)
chr7 (32-198)||(35334832-35334996)
chr7 (33-215)||(43557426-43557611)
chr7 (34-198)||(8148962-8149126)
chr7 (70-215)||(38262195-38262340)
chr7 (33-185)||(46354148-46354302)
chr7 (33-198)||(47077871-47078034)
chr7 (39-216)||(40463837-40464013)
chr7 (55-198)||(23419690-23419833)
chr7 (61-215)||(42391099-42391251)
chr7 (90-215)||(7879649-7879774)
chr7 (53-210)||(33871914-33872070)
chr7 (55-193)||(19266426-19266564)
chr7 (32-213)||(42476826-42477005)
chr7 (33-192)||(2662958-2663112)
chr7 (90-219)||(18512448-18512576)
chr7 (55-194)||(28362165-28362304)
chr7 (55-213)||(29907393-29907552)
chr7 (90-219)||(31591104-31591231)
chr7 (34-123)||(18326989-18327078)
chr7 (33-198)||(22698983-22699151)
chr7 (46-198)||(42101900-42102052)
chr7 (58-213)||(11741774-11741927)
chr7 (54-194)||(13805077-13805216)
chr7 (95-198)||(23231573-23231676)
chr7 (32-195)||(28078151-28078313)
chr7 (98-195)||(38604546-38604642)
chr7 (37-198)||(14732837-14732999)
chr7 (55-215)||(19265791-19265949)
chr7 (104-216)||(35787267-35787378)
chr7 (55-190)||(14099030-14099165)
chr7 (55-190)||(14409047-14409182)
chr7 (32-123)||(42495926-42496017)
chr7 (91-185)||(1408469-1408563)
chr7 (54-189)||(7644931-7645066)
chr7 (92-198)||(18747499-18747606)
chr7 (55-190)||(48123508-48123643)
chr7 (50-124)||(7794596-7794670)
chr7 (55-198)||(3469191-3469338)
chr7 (33-134)||(7193039-7193140)
chr7 (32-149)||(12473257-12473374)
chr7 (70-202)||(23223669-23223801)
chr7 (131-215)||(27889315-27889399)
chr7 (54-216)||(39123865-39124032)
chr7 (34-133)||(5180238-5180337)
chr7 (33-124)||(21447544-21447635)
chr7 (85-198)||(21566441-21566555)
chr7 (164-214)||(45018923-45018973)
chr7 (308-368)||(42312744-42312804)
chr7 (55-195)||(44123641-44123780)
chr7 (50-149)||(1423975-1424074)
chr7 (308-355)||(6694762-6694809)
chr7 (308-354)||(29710379-29710425)
chr7 (90-215)||(32233134-32233258)
chr7 (308-368)||(6694516-6694576)
chr7 (308-368)||(27280599-27280659)
chr7 (308-351)||(3198273-3198316)
chr7 (164-211)||(42495865-42495912)
chr7 (308-354)||(6222079-6222125)
chr7 (308-354)||(27576623-27576669)
chr7 (36-134)||(29140440-29140538)
chr7 (308-354)||(29710612-29710658)
chr7 (309-354)||(11975506-11975551)
chr7 (90-194)||(16341289-16341394)
chr7 (308-368)||(29710305-29710365)
chr7 (308-368)||(31453074-31453134)
chr7 (167-215)||(36602535-36602583)
chr7 (56-123)||(6736867-6736934)
chr7 (110-217)||(23065922-23066029)
chr7 (308-351)||(30869632-30869675)
chr7 (151-198)||(33500587-33500634)
chr7 (308-354)||(11975673-11975719)
chr7 (307-357)||(41666375-41666425)
chr7 (310-351)||(4048264-4048305)
chr7 (308-353)||(6069293-6069338)
chr7 (116-203)||(17048826-17048914)
chr7 (308-368)||(27280901-27280961)
chr7 (308-368)||(30869692-30869752)
chr7 (90-195)||(35203450-35203557)
chr7 (151-207)||(47514793-47514848)
[»] chr6 (71 HSPs)
chr6 (33-216)||(1354755-1354936)
chr6 (32-215)||(29355854-29356040)
chr6 (33-215)||(1346918-1347098)
chr6 (50-215)||(12221913-12222081)
chr6 (32-215)||(9161076-9161260)
chr6 (35-198)||(3815093-3815256)
chr6 (50-215)||(2166409-2166576)
chr6 (50-215)||(2178042-2178209)
chr6 (46-215)||(24097548-24097713)
chr6 (33-215)||(1941809-1941991)
chr6 (46-198)||(12889394-12889546)
chr6 (50-192)||(14553483-14553626)
chr6 (32-147)||(8409196-8409311)
chr6 (97-215)||(26097178-26097294)
chr6 (33-198)||(15866055-15866218)
chr6 (97-215)||(25557743-25557859)
chr6 (34-183)||(13905011-13905158)
chr6 (32-124)||(14975170-14975262)
chr6 (37-217)||(23930124-23930303)
chr6 (50-176)||(6024204-6024332)
chr6 (106-198)||(19340855-19340947)
chr6 (64-195)||(18277212-18277343)
chr6 (90-197)||(32579437-32579543)
chr6 (56-215)||(32728156-32728314)
chr6 (65-198)||(23240840-23240971)
chr6 (90-198)||(7947387-7947496)
chr6 (37-154)||(20400625-20400742)
chr6 (308-368)||(21598738-21598798)
chr6 (90-198)||(33138844-33138952)
chr6 (142-215)||(13267788-13267861)
chr6 (308-368)||(10356554-10356614)
chr6 (308-368)||(13273053-13273113)
chr6 (152-215)||(6808468-6808531)
chr6 (30-190)||(22967122-22967287)
chr6 (30-190)||(23821106-23821271)
chr6 (37-124)||(24734591-24734678)
chr6 (151-216)||(12885985-12886050)
chr6 (57-170)||(28007604-28007717)
chr6 (152-215)||(12892082-12892145)
chr6 (308-355)||(35225396-35225443)
chr6 (102-195)||(9671103-9671197)
chr6 (308-354)||(10356494-10356540)
chr6 (89-215)||(12228368-12228494)
chr6 (308-354)||(21598504-21598550)
chr6 (308-354)||(21598678-21598724)
chr6 (55-198)||(2755436-2755583)
chr6 (164-197)||(10734922-10734955)
chr6 (61-153)||(4136578-4136670)
chr6 (308-368)||(9982655-9982715)
chr6 (157-197)||(11395839-11395879)
chr6 (308-368)||(17136829-17136889)
chr6 (307-350)||(17342672-17342715)
chr6 (308-351)||(17342733-17342776)
chr6 (71-134)||(17432332-17432395)
chr6 (308-355)||(21598443-21598490)
chr6 (112-186)||(24751101-24751176)
chr6 (33-100)||(33922942-33923009)
chr6 (140-214)||(383760-383834)
chr6 (151-197)||(3116146-3116192)
chr6 (308-354)||(10356320-10356366)
chr6 (308-354)||(35050813-35050859)
chr6 (311-368)||(3848533-3848590)
chr6 (307-352)||(35050757-35050802)
chr6 (308-368)||(2761634-2761694)
chr6 (308-368)||(9982962-9983022)
chr6 (308-368)||(10356246-10356306)
chr6 (36-124)||(12063424-12063512)
chr6 (159-215)||(20906785-20906841)
chr6 (324-368)||(24059653-24059696)
chr6 (159-195)||(29016301-29016337)
chr6 (309-353)||(35225458-35225502)
[»] scaffold0168 (1 HSPs)
scaffold0168 (33-215)||(30533-30713)
[»] scaffold0311 (1 HSPs)
scaffold0311 (50-198)||(10781-10929)
[»] scaffold1176 (1 HSPs)
scaffold1176 (54-219)||(1583-1745)
[»] scaffold0258 (1 HSPs)
scaffold0258 (35-215)||(13023-13202)
[»] scaffold0223 (1 HSPs)
scaffold0223 (40-214)||(11093-11264)
[»] scaffold0049 (1 HSPs)
scaffold0049 (50-198)||(58948-59098)
[»] scaffold0187 (4 HSPs)
scaffold0187 (36-192)||(10072-10226)
scaffold0187 (36-192)||(20400-20554)
scaffold0187 (30-98)||(8896-8964)
scaffold0187 (30-98)||(19224-19292)
[»] scaffold0018 (3 HSPs)
scaffold0018 (90-214)||(72867-72992)
scaffold0018 (308-355)||(161402-161449)
scaffold0018 (308-354)||(161697-161743)
[»] scaffold0015 (1 HSPs)
scaffold0015 (90-216)||(48632-48756)
[»] scaffold0954 (1 HSPs)
scaffold0954 (95-198)||(3560-3663)
[»] scaffold0254 (1 HSPs)
scaffold0254 (50-177)||(4128-4258)
[»] scaffold0005 (1 HSPs)
scaffold0005 (32-162)||(226457-226588)
[»] scaffold0180 (1 HSPs)
scaffold0180 (127-215)||(24132-24220)
[»] scaffold0036 (1 HSPs)
scaffold0036 (50-183)||(35048-35183)
[»] scaffold0116 (1 HSPs)
scaffold0116 (53-123)||(8865-8935)
[»] scaffold0194 (1 HSPs)
scaffold0194 (34-110)||(24619-24695)
[»] scaffold0167 (1 HSPs)
scaffold0167 (90-194)||(23610-23714)
[»] scaffold0024 (1 HSPs)
scaffold0024 (32-107)||(83828-83903)
[»] scaffold0279 (1 HSPs)
scaffold0279 (308-354)||(1227-1273)
[»] scaffold0031 (1 HSPs)
scaffold0031 (50-123)||(43100-43173)


Alignment Details
Target: chr4 (Bit Score: 321; Significance: 0; HSPs: 115)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 321; E-Value: 0
Query Start/End: Original strand, 36 - 420
Target Start/End: Original strand, 14983791 - 14984175
Alignment:
36 gggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggt 135  Q
    ||||||||| |||| ||||||||||||||||||||| ||| | ||||| |||   |||||||| |  |||||||||||||||||||||||||||||||||    
14983791 gggtaaccttggcagaactggtaaagttgttgtcatatgattggaaggtcacggattcaagtctttgaaacagcctcttgtgtaaaaaatagggtaaggt 14983890  T
136 tgcctacaatacactaaatgatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgcccttttatttcaaatcatgctttaca 235  Q
    |||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||    
14983891 tgcctacaatacactaaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgcccttttattccaaatcatgctttaca 14983990  T
236 gaagtttactacataactacaaaatattaggttaaattacaccaggggttctttaagtcctttaagtttgtgaaataacttaaaagaccaatatgttaca 335  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||    
14983991 gaagtttactacataactacaaaatattaggttaaattacaccaggggttctttaagtcctttaagtttgtgaaataacttaaaggaccaatatgttaca 14984090  T
336 aacatcaaacttaaaggacctctgatgtaattttcccaaaatattatttgctatagagactccaggtgcaccatcgagttgtgtt 420  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
14984091 aacatcaaacttaaaggacctctgatgtaattttcccaaaatattatttgctatagagactccaggtgcaccatcgagttgtgtt 14984175  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 32 - 215
Target Start/End: Original strand, 5648212 - 5648394
Alignment:
32 tgaggggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggta 131  Q
    ||||||||||||| ||| ||||||||||||||||||||||||||||  |||| |||  |||||||||||| |||||||||||||||| ||||| ||||||    
5648212 tgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaaggtcacgggttcaagtcctggaaacagcctcttgtgt-aaaaacagggta 5648310  T
132 aggttgcctacaatacactaaatgatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgccctttt 215  Q
    ||| ||| |||||||||| ||||| |||||| |||||||||||||||||||||||||||||| |||| ||   |||||||||||    
5648311 aggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgcgggagcttcagtgcactgggttgccctttt 5648394  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 31 - 213
Target Start/End: Complemental strand, 6430808 - 6430627
Alignment:
31 ttgaggggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggt 130  Q
    |||||||||||||| ||| ||||||||||||||||||||||||||||  |||| |||  ||||||||| || ||||||||||||||||| |||| |||||    
6430808 ttgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcatggaaacagcctcttgtgta-aaaacagggt 6430710  T
131 aaggttgcctacaatacactaaatgatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgccctt 213  Q
    |||| ||| |||||||||| ||||| ||||||  |||||||||||||||||||||||||||||||| | |||  |||||||||    
6430709 aaggctgcgtacaatacaccaaatggtgggaccacttcccggaccctgcgtatgcgggagctttagcgcaccgggttgccctt 6430627  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 94; E-Value: 9e-46
Query Start/End: Original strand, 33 - 211
Target Start/End: Original strand, 21646918 - 21647098
Alignment:
33 gaggggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaa 132  Q
    ||||| |||||| ||| |||||||||||||||||||||||||||| ||||| |||| |||||||||||| ||||||||||||||||||||||||||||||    
21646918 gagggataaccttggcgcaactggtaaagttgttgtcatgtgactggaaggtcacaggttcaagtcctggaaacagcctcttgtgtaaaaaatagggtaa 21647017  T
133 ggttgcctacaatacacta--aatgatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgccc 211  Q
    || ||| ||||||| || |  |||| |||||| ||||||| ||||| || |||||||||||||||||| |||  |||||||    
21647018 ggctgcgtacaatataccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccc 21647098  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 30 - 214
Target Start/End: Original strand, 20224935 - 20225117
Alignment:
30 tttgaggggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaataggg 129  Q
    ||||||||||||||| ||| ||||||||||||||||||||||||||||  |||| ||   |||||||||||| ||||| |||||||||||||| |  |||    
20224935 tttgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcatgggttcaagtcctggaaacaacctcttgtgtaaaaca--ggg 20225032  T
130 taaggttgcctacaatacactaaatgatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgcccttt 214  Q
    ||||| ||| |||||||||| ||||| |||||| |||||||||||||||| |||||||||||| ||||| |||  ||||||||||    
20225033 taaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt 20225117  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 89; E-Value: 9e-43
Query Start/End: Original strand, 36 - 217
Target Start/End: Original strand, 16911519 - 16911702
Alignment:
36 gggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggt 135  Q
    ||||||||| ||| ||||||||||||||||||||||||||||  |||| |||  |||||||||||  ||||||||||||||||| |||  |||||||||     
16911519 gggtaaccttggcgcaactggtaaagttgttgtcatgtgacttaaaggtcacgggttcaagtcctagaaacagcctcttgtgtacaaatcagggtaaggc 16911618  T
136 tgcctacaatacacta--aatgatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgcccttttat 217  Q
    ||| |||||||||| |  |||| |||||| ||||||||||||||||||| |||||||||||||| ||||  |||||||||||||    
16911619 tgcgtacaatacaccaataatggtgggaccccttcccggaccctgcgtacgcgggagctttagtttaccgggttgcccttttat 16911702  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 89; E-Value: 9e-43
Query Start/End: Original strand, 32 - 215
Target Start/End: Complemental strand, 48599005 - 48598824
Alignment:
32 tgaggggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggta 131  Q
    ||||||||||||| ||| ||||||||||||||||||||||||||||  |||| |||  |||||||||||| ||||||||||||||||  |||| ||||||    
48599005 tgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgt--aaaacagggta 48598908  T
132 aggttgcctacaatacactaaatgatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgccctttt 215  Q
    ||| ||| |||||||||| ||||| |||||| |||||||||||| ||| ||||| |||||| ||||| |||  |||||||||||    
48598907 aggctgcgtacaatacaccaaatggtgggaccccttcccggaccatgcatatgccggagctctagtgcaccgggttgccctttt 48598824  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 88; E-Value: 4e-42
Query Start/End: Original strand, 32 - 215
Target Start/End: Original strand, 30639333 - 30639515
Alignment:
32 tgaggggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggta 131  Q
    ||||||||||||| ||| |||||||||||||||||||| |||||||  |||| |||  |||||||||||| |||||| ||||||||| ||||| ||||||    
30639333 tgaggggtaaccttggcgcaactggtaaagttgttgtcttgtgactgaaaggtcactggttcaagtcctggaaacagactcttgtgt-aaaaacagggta 30639431  T
132 aggttgcctacaatacactaaatgatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgccctttt 215  Q
    ||| ||| |||||||||| ||||| || ||| |||||||||||||||| |||||||||||||||||| ||   |||||||||||    
30639432 aggctgcgtacaatacaccaaatggtgagaccccttcccggaccctgcatatgcgggagctttagtgcactgggttgccctttt 30639515  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 88; E-Value: 4e-42
Query Start/End: Original strand, 33 - 215
Target Start/End: Complemental strand, 47528709 - 47528529
Alignment:
33 gaggggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaa 132  Q
    |||||||||||| ||  ||||||||||||||||||||||||||||  |||| |||| |||||||||||| ||||||||||||||||  |||| |||||||    
47528709 gaggggtaaccttggtgcaactggtaaagttgttgtcatgtgactgaaaggtcacaggttcaagtcctggaaacagcctcttgtgt--aaaacagggtaa 47528612  T
133 ggttgcctacaatacactaaatgatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgccctttt 215  Q
    || ||| |||||||||| ||||| |||||| |||||||||||||||  |||| ||||||| ||||| |||  |||||||||||    
47528611 ggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgaatatgtgggagctctagtgcaccgggttgccctttt 47528529  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #10
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 32 - 215
Target Start/End: Complemental strand, 5306845 - 5306659
Alignment:
32 tgaggggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggta 131  Q
    ||||||||||||| ||| ||||||||||||||| ||||||||||||  |||| |||  |||||||||||| |||||||||||||||| ||||  ||||||    
5306845 tgaggggtaaccttggcgcaactggtaaagttgatgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgt-aaaatcagggta 5306747  T
132 aggttgcctacaatacactaaatgatgggactccttcccggaccctgcgtatg----cgggagctttagtgtaccatgttgccctttt 215  Q
    ||||||| |||||||||| ||||| |||||| |||||||||||||||||||||    ||||||||||| || |||  |||||||||||    
5306746 aggttgcgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgtggacgggagctttaatgcaccgggttgccctttt 5306659  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #11
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 40 - 215
Target Start/End: Complemental strand, 16408777 - 16408600
Alignment:
40 aacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcc 139  Q
    ||||| ||| |||||||||||||||||||||||||||| ||||| |||  |||||||||||| |||||||||||||||||||||| ||||||||  |||     
16408777 aaccttggcgcaactggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaagactgcg 16408678  T
140 tacaatacacta--aatgatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgccctttt 215  Q
    |||||||||| |  |||| ||| || ||||||||||||| || |||||||||||||||||| |||  |||||||||||    
16408677 tacaatacaccaataatggtggaaccccttcccggaccccgcatatgcgggagctttagtgcaccgggttgccctttt 16408600  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #12
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 33 - 215
Target Start/End: Original strand, 23501747 - 23501925
Alignment:
33 gaggggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaa 132  Q
    |||||||||||| ||| ||||||||||||||||||||||||||||  |||| |||  |||||||||      |||||||||||||||||||| |||||||    
23501747 gaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtc------acagcctcttgtgtaaaaaacagggtaa 23501840  T
133 ggttgcctacaatacactaa--atgatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgccctttt 215  Q
    |||||| |||||||||| ||  ||| |||||| |||||||||||||||| |||||||||||||||||| |||  |||||||||||    
23501841 ggttgcgtacaatacaccaataatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgccctttt 23501925  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #13
Raw Score: 86; E-Value: 6e-41
Query Start/End: Original strand, 33 - 198
Target Start/End: Original strand, 37494805 - 37494970
Alignment:
33 gaggggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaa 132  Q
    |||||||||||| ||  |||||||||||||||||| |||| ||||  |||| |||| |||||||||||| ||||| |||||||||||||||| |||||||    
37494805 gaggggtaaccttggtgcaactggtaaagttgttgccatgcgactgaaaggtcacaggttcaagtcctggaaacaacctcttgtgtaaaaaacagggtaa 37494904  T
133 ggttgcctacaatacactaaatgatgggactccttcccggaccctgcgtatgcgggagctttagtg 198  Q
    |||||| ||||||| || ||||| |||||| |||| | ||||||||||||||| ||||||||||||    
37494905 ggttgcatacaatataccaaatggtgggacccctttcgggaccctgcgtatgcaggagctttagtg 37494970  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #14
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 52 - 198
Target Start/End: Original strand, 40915802 - 40915947
Alignment:
52 actggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacacta 151  Q
    ||||||||||||||||||||||||||| |||| |||  |||||||||||| |||||||||||||||| ||||| | ||||||| ||| |||||||||| |    
40915802 actggtaaagttgttgtcatgtgactataaggtcacgggttcaagtcctggaaacagcctcttgtgt-aaaaacaaggtaaggctgcgtacaatacacca 40915900  T
152 aatgatgggactccttcccggaccctgcgtatgcgggagctttagtg 198  Q
    |||| |||||  |||||||||||||||||||||||||||||| ||||    
40915901 aatggtgggagcccttcccggaccctgcgtatgcgggagcttcagtg 40915947  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #15
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 52 - 214
Target Start/End: Complemental strand, 44363294 - 44363130
Alignment:
52 actggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacac-- 149  Q
    ||||||||||||||||||||||||||  |||| |||  ||||||||||||||||||||||| ||||||||||| |||||| || ||| |||||  |||      
44363294 actggtaaagttgttgtcatgtgactgaaaggtcacgagttcaagtcctgaaaacagcctcgtgtgtaaaaaacagggtagggctgcgtacaacgcacca 44363195  T
150 taaatgatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgcccttt 214  Q
     ||||| |||||| ||||||||||||||||||||||||||||||||||| |||  ||||||||||    
44363194 aaaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttt 44363130  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #16
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 33 - 215
Target Start/End: Complemental strand, 11054327 - 11054147
Alignment:
33 gaggggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaa 132  Q
    |||||||||| | ||| ||||||||||||||||||||||||||||  |||| |||  ||||||||||||||||||| |||||||||  |||| |||||||    
11054327 gaggggtaactttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctgaaaacagtctcttgtgt--aaaacagggtaa 11054230  T
133 ggttgcctacaatacactaaatgatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgccctttt 215  Q
    |  ||| |||||||||| |||||  || || |||||||||||||||| |||||||||||| ||||| |||  |||||||||||    
11054229 gactgcgtacaatacaccaaatggcggaaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctttt 11054147  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #17
Raw Score: 74; E-Value: 8e-34
Query Start/End: Original strand, 33 - 195
Target Start/End: Original strand, 10660358 - 10660521
Alignment:
33 gaggggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaa 132  Q
    |||||||||||| ||| ||||||||||||||||||||||||||||  ||||  |||||||||||||||| ||||| |||||| ||||||||||||||||     
10660358 gaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggttacatgttcaagtcctggaaacaacctcttatgtaaaaaatagggtat 10660457  T
133 ggttgcctacaatacacta--aatgatgggactccttcccggaccctgcgtatgcgggagcttta 195  Q
    || ||| |||||||||| |  |||| || ||| ||||||  || |||||||||||||||||||||    
10660458 ggctgcatacaatacaccaataatggtgagaccccttccaaga-cctgcgtatgcgggagcttta 10660521  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #18
Raw Score: 74; E-Value: 8e-34
Query Start/End: Original strand, 33 - 195
Target Start/End: Original strand, 10874503 - 10874666
Alignment:
33 gaggggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaa 132  Q
    |||||||||||| ||| ||||||||||||||||||||||||||||  ||||  |||||||||||||||| ||||| |||||| ||||||||||||||||     
10874503 gaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggttacatgttcaagtcctggaaacaacctcttatgtaaaaaatagggtat 10874602  T
133 ggttgcctacaatacacta--aatgatgggactccttcccggaccctgcgtatgcgggagcttta 195  Q
    || ||| |||||||||| |  |||| || ||| ||||||  || |||||||||||||||||||||    
10874603 ggctgcatacaatacaccaataatggtgagaccccttccaaga-cctgcgtatgcgggagcttta 10874666  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #19
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 59 - 195
Target Start/End: Complemental strand, 17043549 - 17043413
Alignment:
59 aagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacactaaatgatg 158  Q
    |||||||||||| ||||||  |||| |||| |||||||||||| |||||||||||||||||||| | ||||||||| ||| |||||||||| ||||| ||    
17043549 aagttgttgtcaagtgactgaaaggtcacaggttcaagtcctggaaacagcctcttgtgtaaaatacagggtaaggctgcgtacaatacaccaaatggtg 17043450  T
159 ggactccttcccggaccctgcgtatgcgggagcttta 195  Q
    |||| ||||||| |||||||| ||||| |||||||||    
17043449 ggaccccttcccagaccctgcatatgctggagcttta 17043413  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #20
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 96 - 215
Target Start/End: Complemental strand, 20639777 - 20639657
Alignment:
96 gtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacactaaa-tgatgggactccttcccggaccctgcgtatgcgggagcttt 194  Q
    |||||| |||||||||||||||||||||| ||||||||| ||| |||||||||| ||| || |||||| |||||||||||||||||||||||||||||||    
20639777 gtcctggaaacagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaaaatggtgggaccccttcccggaccctgcgtatgcgggagcttt 20639678  T
195 agtgtaccatgttgccctttt 215  Q
    |||| |||  |||||||||||    
20639677 agtgcaccgggttgccctttt 20639657  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #21
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 30 - 198
Target Start/End: Original strand, 54730200 - 54730371
Alignment:
30 tttgaggggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgt-aaaaaatagg 128  Q
    ||||| ||||||| | ||| |||  |||||||||||||||||||||| | |||| |||  |||||||||||  |||||||||||||||| ||||||||||    
54730200 tttgatgggtaactttggcgcaatcggtaaagttgttgtcatgtgaccaaaaggtcacgggttcaagtcctagaaacagcctcttgtgtaaaaaaatagg 54730299  T
129 gtaaggttgcctacaatacacta--aatgatgggactccttcccggaccctgcgtatgcgggagctttagtg 198  Q
     ||||| ||| || ||||||| |  |||||||| || |||||||||||||||||||||||||||||||||||    
54730300 ataaggctgcgtataatacaccaataatgatggaaccccttcccggaccctgcgtatgcgggagctttagtg 54730371  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #22
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 34 - 194
Target Start/End: Original strand, 54966977 - 54967135
Alignment:
34 aggggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaag 133  Q
    ||||| ||||| ||| |||| |||||||||||||||||||||||  |||| ||||||||||||| ||| ||| | |||||||||||||||| ||||||||    
54966977 agggggaaccttggcgcaac-ggtaaagttgttgtcatgtgactgaaaggtcacatgttcaagttctggaaagaacctcttgtgtaaaaaacagggtaag 54967075  T
134 gttgcctacaatacactaaatgatgggactccttcccggaccctgcgtatgcgggagcttt 194  Q
    |||| |||||||| || ||||| |||||| |||||||| ||||| | ||||||||||||||    
54967076 gttg-ctacaatataccaaatggtgggaccccttcccgtaccctacatatgcgggagcttt 54967135  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #23
Raw Score: 69; E-Value: 8e-31
Query Start/End: Original strand, 33 - 215
Target Start/End: Complemental strand, 13256578 - 13256398
Alignment:
33 gaggggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaa 132  Q
    |||||||||||| ||  |||||||||||||||||||||||||||| ||||| || | ||||||||||||     |||||||||||||||||| |||||||    
13256578 gaggggtaaccttggtgcaactggtaaagttgttgtcatgtgactggaaggtcataggttcaagtcctg----gagcctcttgtgtaaaaaacagggtaa 13256483  T
133 ggttgcctacaatacacta--aatgatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgccctttt 215  Q
    || ||| |||||||||| |  |||  |||||| |||||||| |||| || | |||||||||||||||| |||  |||||||||||    
13256482 ggctgcgtacaatacaccaataatagtgggaccccttcccgaaccccgcatctgcgggagctttagtgcaccgggttgccctttt 13256398  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #24
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 57 - 214
Target Start/End: Complemental strand, 30690340 - 30690176
Alignment:
57 taaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaata-------gggtaaggttgcctacaatacac 149  Q
    |||||| ||||||| ||||||  |||| |||  |||||||||||| ||| ||||||||||||||||||||       |||||||| ||| ||||||||||    
30690340 taaagtggttgtcaagtgactgaaaggtcacgggttcaagtcctggaaaaagcctcttgtgtaaaaaataaaaaacagggtaaggctgcatacaatacac 30690241  T
150 taaatgatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgcccttt 214  Q
     || || |||||| ||||||||||||||||||||||||||||||||||| |||| | ||||||||    
30690240 caattggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccaggctgcccttt 30690176  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #25
Raw Score: 66; E-Value: 5e-29
Query Start/End: Original strand, 62 - 191
Target Start/End: Complemental strand, 7385628 - 7385499
Alignment:
62 ttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacactaaatgatggga 161  Q
    ||||||||||||||||  |||| |||  ||||||| |||| |||||||||| ||||||||||||||||||||||||  | |||||||| ||||| |||||    
7385628 ttgttgtcatgtgactgaaaggtcacgggttcaagccctggaaacagcctcatgtgtaaaaaatagggtaaggttgtgtgcaatacaccaaatggtggga 7385529  T
162 ctccttcccggaccctgcgtatgcgggagc 191  Q
    | | ||||||||||||| ||||||||||||    
7385528 ccctttcccggaccctgtgtatgcgggagc 7385499  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #26
Raw Score: 66; E-Value: 5e-29
Query Start/End: Original strand, 65 - 194
Target Start/End: Original strand, 25463108 - 25463237
Alignment:
65 ttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacactaaatgatgggactc 164  Q
    |||||||||||||  |||| |||  |||||||||||| ||||| ||||||||||||||||  ||| |||||||| ||||| |||| ||||| |||||| |    
25463108 ttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacaacctcttgtgtaaaaaactgggaaaggttgcgtacaacacaccaaatggtgggaccc 25463207  T
165 cttcccggaccctgcgtatgcgggagcttt 194  Q
    ||||||||||||||| ||||||||||||||    
25463208 cttcccggaccctgcatatgcgggagcttt 25463237  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #27
Raw Score: 66; E-Value: 5e-29
Query Start/End: Original strand, 90 - 215
Target Start/End: Original strand, 47443968 - 47444093
Alignment:
90 gttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacactaaatgatgggactccttcccggaccctgcgtatgcggga 189  Q
    |||||||||||| ||||||||||||| |||||||| ||||||||| ||| |||||||||| ||||| |||||| |||||||||||||||| ||||| |||    
47443968 gttcaagtcctggaaacagcctcttgcgtaaaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcagga 47444067  T
190 gctttagtgtaccatgttgccctttt 215  Q
    |||| |||| ||   |||||||||||    
47444068 gcttcagtgcactgggttgccctttt 47444093  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #28
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 103 - 215
Target Start/End: Original strand, 25629073 - 25629185
Alignment:
103 aaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacactaaatgatgggactccttcccggaccctgcgtatgcgggagctttagtgtacc 202  Q
    |||||| ||||||||||||||||||||||||| ||  |||||||||| ||||| |||||| |||||||||||||| | |||||||||||||||||| |||    
25629073 aaacagtctcttgtgtaaaaaatagggtaaggctgtgtacaatacaccaaatggtgggaccccttcccggaccctacatatgcgggagctttagtgcacc 25629172  T
203 atgttgccctttt 215  Q
      |||||||||||    
25629173 gggttgccctttt 25629185  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #29
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 55 - 215
Target Start/End: Original strand, 35567146 - 35567306
Alignment:
55 ggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacactaaat 154  Q
    ||||||||||||||||||| |||  |||| ||   ||||||||| || |||||||| ||||||||||||| ||||||||| ||  ||||| |||| ||||    
35567146 ggtaaagttgttgtcatgtaactgaaaggtcatgggttcaagtcttggaaacagccacttgtgtaaaaaacagggtaaggctgtgtacaacacaccaaat 35567245  T
155 gatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgccctttt 215  Q
    | |||||| |||||||| ||||||||| |||||||||||||||| |||  | |||||||||    
35567246 ggtgggaccccttcccgaaccctgcgtctgcgggagctttagtgcaccgggctgccctttt 35567306  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #30
Raw Score: 64; E-Value: 8e-28
Query Start/End: Original strand, 57 - 215
Target Start/End: Complemental strand, 9832468 - 9832312
Alignment:
57 taaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacactaaatga 156  Q
    |||| ||||||| || |||||  |||| |||  ||||||||||||||||||||||||||||||||| |  |||||||| ||| |||||||||| |||||     
9832468 taaaattgttgtgatctgactgaaaggtcacgggttcaagtcctgaaaacagcctcttgtgtaaaaca--gggtaaggctgcgtacaatacaccaaatgg 9832371  T
157 tgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgccctttt 215  Q
    |||||| |||||||||||||||| ||||| ||| || ||||| |||  |||||||||||    
9832370 tgggaccccttcccggaccctgcatatgcaggaactctagtgcaccgggttgccctttt 9832312  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #31
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 55 - 196
Target Start/End: Complemental strand, 39029220 - 39029078
Alignment:
55 ggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacac-taaa 153  Q
    ||||||||||||||| |||||||| |||| || | ||||||| | || |||||||||||||||||||||| ||||||||| ||  ||||||||||  |||    
39029220 ggtaaagttgttgtcgtgtgactaaaaggtcataggttcaagccttggaaacagcctcttgtgtaaaaaacagggtaaggctgtgtacaatacacgaaaa 39029121  T
154 tgatgggactccttcccggaccctgcgtatgcgggagctttag 196  Q
    || ||||||  ||| ||||||||||| ||||||||||||||||    
39029120 tggtgggaccactttccggaccctgcatatgcgggagctttag 39029078  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #32
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 54 - 198
Target Start/End: Original strand, 19027823 - 19027967
Alignment:
54 tggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacactaaa 153  Q
    ||||| ||||||||||| ||||||  |||| |||  |||||||||||| ||||| | |||||||||||||| ||||||||| ||| |||||||||| ||     
19027823 tggtagagttgttgtcacgtgactgaaaggtcacgggttcaagtcctggaaacaacatcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaat 19027922  T
154 tgatgggactccttcccggaccctgcgtatgcgggagctttagtg 198  Q
    || |||||| |||| || ||| ||||||||| |||||||||||||    
19027923 tggtgggacccctttccagactctgcgtatgtgggagctttagtg 19027967  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #33
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 33 - 215
Target Start/End: Complemental strand, 20908818 - 20908635
Alignment:
33 gaggggtaacctcggcacaactggtaaagttgttgtcatgtgact-agaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggta 131  Q
    |||||| | ||| |||||||| ||||||||||||||||||||||| | || |  ||||||||||||| || ||||| | |||| | ||||||| | ||||    
20908818 gagggggagccttggcacaac-ggtaaagttgttgtcatgtgactgaaaatgttacatgttcaagtcatggaaacatcgtcttttctaaaaaagaaggta 20908720  T
132 aggttgcctacaatacactaaa-tgatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgccctttt 215  Q
    ||| ||| |||||||||| ||| || |||||| |||||||| |||||||||||||||||||||||||| || | | |||||||||    
20908719 aggctgcgtacaatacaccaaaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcacaaggctgccctttt 20908635  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #34
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 103 - 195
Target Start/End: Complemental strand, 51865149 - 51865057
Alignment:
103 aaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacactaaatgatgggactccttcccggaccctgcgtatgcgggagcttta 195  Q
    |||||||||||||||||||||| | ||||||| ||| |||||||||| ||||| |||| | ||||||||||||||||||||||||||||||||    
51865149 aaacagcctcttgtgtaaaaaacatggtaaggctgcgtacaatacaccaaatggtggggccccttcccggaccctgcgtatgcgggagcttta 51865057  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #35
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 33 - 198
Target Start/End: Original strand, 20405047 - 20405208
Alignment:
33 gaggggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaat-agggta 131  Q
    |||||||||||| | | |||||||||||||||||||||||||||| ||||| |||  |       |||  ||||||||||||||||||||||  ||||||    
20405047 gaggggtaaccttgacgcaactggtaaagttgttgtcatgtgactggaaggtcacggg-------cctagaaacagcctcttgtgtaaaaaaacagggta 20405139  T
132 aggttgcctacaatacactaa--atgatgggactccttcccggaccctgcgtatgcgggagctttagtg 198  Q
    || |||| |||||||||||||  ||| |||||| ||||||||||||| || ||||||||||||||||||    
20405140 agattgcgtacaatacactaataatggtgggaccccttcccggaccccgcatatgcgggagctttagtg 20405208  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #36
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 58 - 198
Target Start/End: Complemental strand, 30496476 - 30496338
Alignment:
58 aaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacactaaatgat 157  Q
    ||||||||||||| ||||||  |||| ||| |||||||||| || ||||||||||||||||||| |   |||||||| ||| |||||||||| |||||      
30496476 aaagttgttgtcacgtgactgaaaggtcacgtgttcaagtcatggaaacagcctcttgtgtaaacac--gggtaaggctgcatacaatacaccaaatggg 30496379  T
158 gggactccttcccggaccctgcgtatgcgggagctttagtg 198  Q
    |||||||||||||||||| ||| ||||  ||||||||||||    
30496378 gggactccttcccggaccgtgcttatgatggagctttagtg 30496338  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #37
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 91 - 195
Target Start/End: Complemental strand, 9987957 - 9987853
Alignment:
91 ttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacactaaatgatgggactccttcccggaccctgcgtatgcgggag 190  Q
    ||||||||||| ||||| ||||||||||||| |||||||||||| ||| |||||||||| ||||| |||||| ||||||  |||| ||| ||||||||||    
9987957 ttcaagtcctggaaacaacctcttgtgtaaacaatagggtaaggctgcatacaatacaccaaatggtgggaccccttccttgaccttgcatatgcgggag 9987858  T
191 cttta 195  Q
    |||||    
9987857 cttta 9987853  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #38
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 38 - 215
Target Start/End: Complemental strand, 30352767 - 30352579
Alignment:
38 gtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaata-----gggtaa 132  Q
    ||||||| ||| ||||||||||||||||||||| |||||   |||| |||  |||  ||||||| |||||||||||||||||||||| |     ||||||    
30352767 gtaaccttggcgcaactggtaaagttgttgtcaagtgaccgaaaggtcacgggttagagtcctggaaacagcctcttgtgtaaaaaaaaaaacagggtaa 30352668  T
133 g----gttgcctacaatacactaaa--tgatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgccctttt 215  Q
    |    | ||| |||||||||| |||  || |||||| ||||| ||||||||||||||||||||||||||||| ||| ||||||||||||    
30352667 gtaaagctgcgtacaatacaccaaaaatggtgggaccccttctcggaccctgcgtatgcgggagctttagtgcaccgtgttgccctttt 30352579  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #39
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 60 - 215
Target Start/End: Complemental strand, 39077948 - 39077795
Alignment:
60 agttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacactaaatgatgg 159  Q
    |||||||||||||||| |  |||| |||  |||||||||||| |||||||||||||||||||| |  |||||||||||| ||||||| || ||||| ||     
39077948 agttgttgtcatgtgattgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaca--gggtaaggttgcgtacaatataccaaatggtga 39077851  T
160 gactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgccctttt 215  Q
    |||  ||| ||||||||||| |||||||||||| ||||| |||  |||||| ||||    
39077850 gacatctttccggaccctgcatatgcgggagctctagtgcaccgggttgccttttt 39077795  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #40
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 90 - 212
Target Start/End: Complemental strand, 29208020 - 29207900
Alignment:
90 gttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacactaaatgatgggactccttcccggaccctgcgtatgcggga 189  Q
    |||||||||||| |||  ||||||||||||||| |  |||||||| ||| |||||||||| ||||| |||||| |||||||||||||||| |||||||||    
29208020 gttcaagtcctggaaattgcctcttgtgtaaaaca--gggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcggga 29207923  T
190 gctttagtgtaccatgttgccct 212  Q
    ||| ||||| |||  ||||||||    
29207922 gctctagtgcaccgggttgccct 29207900  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #41
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 59 - 215
Target Start/End: Original strand, 54175043 - 54175201
Alignment:
59 aagttgttgtcatgtgactagaaggccacatgttcaagtcctg-aaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacactaaa-tga 156  Q
    |||||||||||||||||||  || | |||   ||||||||||| ||||||||||||||||||||||  ||||||||| ||| |||||||||| ||| ||     
54175043 aagttgttgtcatgtgactgaaatgtcacggattcaagtcctggaaaacagcctcttgtgtaaaaac-agggtaaggctgcgtacaatacaccaaaatgg 54175141  T
157 tgggactccttccc-ggaccctgcgtatgcgggagctttagtgtaccatgttgccctttt 215  Q
    |||||| ||||||| ||||||||| |||||||||||||||||| |||  | |||||||||    
54175142 tgggaccccttccccggaccctgcatatgcgggagctttagtgcaccgggctgccctttt 54175201  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #42
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 97 - 198
Target Start/End: Complemental strand, 7909397 - 7909296
Alignment:
97 tcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacactaaatgatgggactccttcccggaccctgcgtatgc-gggagcttta 195  Q
    ||||| |||||| ||||||||||||||  ||||||||||||| |||||||||| ||||| |||||| |||||||| ||||||||||||| ||||||||||    
7909397 tcctggaaacagtctcttgtgtaaaaac-agggtaaggttgcgtacaatacaccaaatggtgggaccccttcccgaaccctgcgtatgcggggagcttta 7909299  T
196 gtg 198  Q
    |||    
7909298 gtg 7909296  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #43
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 50 - 213
Target Start/End: Complemental strand, 8473784 - 8473621
Alignment:
50 caactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacac 149  Q
    |||||||||||||||||||||| ||||  |||||   |  |||||||||||| ||||||||||||||||    || ||||||||| ||| ||||||||||    
8473784 caactggtaaagttgttgtcatatgaccggaaggttgcgggttcaagtcctggaaacagcctcttgtgt--ttaacagggtaaggctgcatacaatacac 8473687  T
150 taaatgatgggactcctt-cccgga-ccctgcgtatgcgggagctttagtgtaccatgttgccctt 213  Q
     ||||| |||||| |||| |||||| |||||| |||||||||||||||||| |||  |||||||||    
8473686 caaatggtgggaccccttccccggacccctgcatatgcgggagctttagtgcaccgggttgccctt 8473621  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #44
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 32 - 162
Target Start/End: Original strand, 14590790 - 14590921
Alignment:
32 tgaggggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgt-aaaaaatagggt 130  Q
    |||| |||||||| ||| ||||||||||||||||||||||||||||  |||| |||   ||||||||||  |||||||||||||| | |||||| |||||    
14590790 tgagtggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacggattcaagtcctagaaacagcctcttgtctaaaaaaacagggt 14590889  T
131 aaggttgcctacaatacactaaatgatgggac 162  Q
    |||| ||| |||||||||  ||||| ||||||    
14590890 aaggctgcatacaatacatcaaatggtgggac 14590921  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #45
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 55 - 194
Target Start/End: Complemental strand, 47441689 - 47441550
Alignment:
55 ggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacactaaat 154  Q
    |||||||||||||||| ||||||  |||| |||| ||||||||||   |||||| ||||| ||||||||  ||||||||| ||  |||||||||| ||||    
47441689 ggtaaagttgttgtcacgtgactgaaaggtcacaggttcaagtccaagaaacagtctcttttgtaaaaatcagggtaaggctgtgtacaatacaccaaat 47441590  T
155 gatgggactccttcccggaccctgcgtatgcgggagcttt 194  Q
    | | |||| ||||||||||||||| ||| || ||||||||    
47441589 ggttggaccccttcccggaccctgagtaagcaggagcttt 47441550  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #46
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 67 - 216
Target Start/End: Original strand, 7038041 - 7038189
Alignment:
67 gtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaataca-ctaaatgatgggactcc 165  Q
    |||||||||||  |||| |||| ||||||||||||||| |||| |||||||||||||||||||||||  | | ||||||||| | ||||| |||| | ||    
7038041 gtcatgtgactgaaaggtcacaggttcaagtcctgaaa-cagcttcttgtgtaaaaaatagggtaagacttcgtacaatacaccaaaatggtggggcacc 7038139  T
166 ttcccggaccctgcgtatgcgggagctttagtgtaccatgttgccctttta 216  Q
    | |||||||||||||||| | |||||||||||| ||   ||||||||||||    
7038140 tacccggaccctgcgtatac-ggagctttagtgcactgggttgccctttta 7038189  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #47
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 33 - 198
Target Start/End: Complemental strand, 55766647 - 55766482
Alignment:
33 gaggggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatg-ttcaagtcctgaaaacagcctcttgtgtaaaaaatagggta 131  Q
    |||||||||||| | | |||||||||||||||||||||||||||  ||||| |||  | |||||||  || ||||||  ||||||||  |||  ||||||    
55766647 gaggggtaaccttgacgcaactggtaaagttgttgtcatgtgaccggaaggtcacggggttcaagttttggaaacagtttcttgtgtgtaaac-agggta 55766549  T
132 aggttgcctacaatacactaaatgatgggactccttcccggaccctgcgtatgcgggagctttagtg 198  Q
    ||| ||| ||||||||||| |||| ||| || || ||||||||| |||||||||| |||||||||||    
55766548 aggctgcgtacaatacactgaatggtggaaccccatcccggaccttgcgtatgcgagagctttagtg 55766482  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #48
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 33 - 214
Target Start/End: Complemental strand, 55830902 - 55830721
Alignment:
33 gaggggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacat-gttcaagtcctgaaaacagcctcttgtgtaaaaaatagggta 131  Q
    |||||||||||| | | ||||||||||||||||||||||||||   ||||| |||   ||||||||  || |||||| |||||||||  |||  ||||||    
55830902 gaggggtaaccttgacgcaactggtaaagttgttgtcatgtgatcggaaggtcacggagttcaagttttggaaacagtctcttgtgtgtaaac-agggta 55830804  T
132 aggttgcctacaatacactaaatgatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgcccttt 214  Q
    | | ||| ||||||||||| |||| ||| || || ||||||||| |||||||||| ||||||||||| |||| | ||||||||    
55830803 atgctgcgtacaatacactgaatggtggaaccccatcccggaccttgcgtatgcgagagctttagtgcaccaggatgcccttt 55830721  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #49
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 57 - 194
Target Start/End: Complemental strand, 32478942 - 32478811
Alignment:
57 taaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacactaaatga 156  Q
    ||||||||||||||||||||    ||| |||| |||||||||||| ||||| ||||| |||||||||  ||||||||| ||     ||||||| |||||     
32478942 taaagttgttgtcatgtgaccgagaggtcacaggttcaagtcctggaaacaacctctagtgtaaaaac-agggtaaggctg-----aatacaccaaatgg 32478849  T
157 tgggactccttcccggaccctgcgtatgcgggagcttt 194  Q
    |||||| ||||||||||||| |||||||||||||||||    
32478848 tgggaccccttcccggacccagcgtatgcgggagcttt 32478811  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #50
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 58 - 196
Target Start/End: Complemental strand, 49938746 - 49938611
Alignment:
58 aaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacactaaa-tga 156  Q
    ||||||||||||| ||||||  |||| |||| |||||||||||| |||||||||||||||||||||   |||||||||    |||||||||| ||| ||     
49938746 aaagttgttgtcacgtgactgaaaggtcacaggttcaagtcctggaaacagcctcttgtgtaaaaacg-gggtaaggtg---tacaatacaccaaaatgg 49938651  T
157 tgggactccttcccggaccctgcgtatgcgggagctttag 196  Q
    |||||| |||||||  ||||||| ||||||||||||||||    
49938650 tgggaccccttcccataccctgcatatgcgggagctttag 49938611  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #51
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 91 - 194
Target Start/End: Original strand, 21489099 - 21489203
Alignment:
91 ttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacactaaa-tgatgggactccttcccggaccctgcgtatgcggga 189  Q
    ||||||||||| ||||||||||||| |||||||| || |||||  ||| |||||| ||| ||| || |||||| |||||||| |||||||||||||||||    
21489099 ttcaagtcctggaaacagcctcttgcgtaaaaaacagagtaagactgcgtacaatgcaccaaaatggtgggaccccttcccgaaccctgcgtatgcggga 21489198  T
190 gcttt 194  Q
    |||||    
21489199 gcttt 21489203  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #52
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 103 - 193
Target Start/End: Original strand, 49796822 - 49796911
Alignment:
103 aaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacactaaatgatgggactccttcccggaccctgcgtatgcgggagctt 193  Q
    |||||||||||||||| ||||  | ||||||| ||| |||||||||| ||||| |||||| |||||||| |||||||||||||||||||||    
49796822 aaacagcctcttgtgttaaaac-atggtaaggctgcgtacaatacaccaaatggtgggaccccttcccgaaccctgcgtatgcgggagctt 49796911  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #53
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 308 - 368
Target Start/End: Original strand, 7246316 - 7246376
Alignment:
308 aaataacttaaaagaccaatatgttacaaacatcaaacttaaaggacctctgatgtaattt 368  Q
    ||||||||||||||||||||||||||||||| |||||||||||||| |||  |||||||||    
7246316 aaataacttaaaagaccaatatgttacaaacctcaaacttaaaggatctcaaatgtaattt 7246376  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #54
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 62 - 198
Target Start/End: Complemental strand, 41018945 - 41018810
Alignment:
62 ttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacactaaatgatggga 161  Q
    ||||||||| ||||||  |||| |||  |||||||||||| ||||| |||||||||| |||| |||||||||| | | |||||||||| ||||  |||||    
41018945 ttgttgtcacgtgactgaaaggtcacgggttcaagtcctggaaacaacctcttgtgt-aaaattagggtaaggctacgtacaatacaccaaatagtggga 41018847  T
162 ctccttcccggaccctgcgtatgcgggagctttagtg 198  Q
    | ||||||| |||| ||||||||  || |||||||||    
41018846 ccccttcccagaccttgcgtatggaggggctttagtg 41018810  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #55
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 54 - 149
Target Start/End: Original strand, 25343162 - 25343257
Alignment:
54 tggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacac 149  Q
    ||||||||||||||||| ||||||   ||| |||| |||||||| ||| ||| || ||||||||||||||| ||||||||| ||| ||||||||||    
25343162 tggtaaagttgttgtcacgtgactgataggtcacaggttcaagttctggaaatagtctcttgtgtaaaaaacagggtaaggctgcgtacaatacac 25343257  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #56
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 57 - 198
Target Start/End: Complemental strand, 30581624 - 30581481
Alignment:
57 taaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaat-agggtaaggttgcctacaatacactaaa-t 154  Q
    ||||||||||||||  | |||| |||| ||   ||||||||| || ||||| ||||||||||||||||  ||||||||| ||  |||||||||| ||| |    
30581624 taaagttgttgtcacatcactaaaaggtcaagggttcaagtcgtggaaacaacctcttgtgtaaaaaaacagggtaagggtgtgtacaatacaccaaaat 30581525  T
155 gatgggactccttcccggaccctgcgtatgcgggagctttagtg 198  Q
    | |||||| |||||||||||||||| ||||  ||||||||||||    
30581524 ggtgggaccccttcccggaccctgcatatgtaggagctttagtg 30581481  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #57
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 55 - 153
Target Start/End: Complemental strand, 487294 - 487196
Alignment:
55 ggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacactaaa 153  Q
    |||||||||||||||||||||||  |||| |||  ||||||||| || ||||| ||||||||||| |||| | ||||| | ||| ||||||||||||||    
487294 ggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcttggaaacaacctcttgtgtataaaacaaggtaaagctgcgtacaatacactaaa 487196  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #58
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 157 - 215
Target Start/End: Complemental strand, 36816441 - 36816383
Alignment:
157 tgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgccctttt 215  Q
    ||||||||||||| |||||||| |||||||||||||||||||||||  |||||||||||    
36816441 tgggactccttcctggaccctgtgtatgcgggagctttagtgtaccgggttgccctttt 36816383  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #59
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 152 - 214
Target Start/End: Complemental strand, 38755970 - 38755908
Alignment:
152 aatgatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgcccttt 214  Q
    |||| |||||| ||||||||||||||||||||||||||||||||||| |||  ||||||||||    
38755970 aatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttt 38755908  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #60
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 143 - 215
Target Start/End: Original strand, 38786673 - 38786745
Alignment:
143 aatacactaaatgatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgccctttt 215  Q
    ||||||| ||||| |||||| |||||||||||||||| |||||||||||| ||||| |||  |||||||||||    
38786673 aatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctttt 38786745  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #61
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 151 - 214
Target Start/End: Original strand, 11394924 - 11394987
Alignment:
151 aaatgatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgcccttt 214  Q
    ||||| |||||| |||| |||||||||||||||||||||||||||||| |||  ||||||||||    
11394924 aaatggtgggacccctttccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttt 11394987  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #62
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 151 - 214
Target Start/End: Original strand, 11404651 - 11404714
Alignment:
151 aaatgatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgcccttt 214  Q
    ||||| |||||| |||| |||||||||||||||||||||||||||||| |||  ||||||||||    
11404651 aaatggtgggacccctttccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttt 11404714  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #63
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 36 - 123
Target Start/End: Complemental strand, 17315476 - 17315389
Alignment:
36 gggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaa 123  Q
    ||||||||| ||| |||| |||||||||||||||||||||||  |||| |||  |||||| ||||  ||||| |||||||||||||||    
17315476 gggtaaccttggcgcaaccggtaaagttgttgtcatgtgactgaaaggtcacgggttcaattcctcgaaacaacctcttgtgtaaaaa 17315389  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #64
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 126 - 214
Target Start/End: Original strand, 20225121 - 20225211
Alignment:
126 agggtaaggttgcctacaatacactaa--atgatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgcccttt 214  Q
    ||||||||| ||| |||||||||| ||  ||| |||||| ||||||||||||| || |||||||||||||||||| |||  ||||||||||    
20225121 agggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccgggttgcccttt 20225211  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #65
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 152 - 215
Target Start/End: Complemental strand, 33836549 - 33836486
Alignment:
152 aatgatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgccctttt 215  Q
    |||| |||||| ||||||||||||||||||||||||||||||||||| | |  |||||||||||    
33836549 aatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaacgggttgccctttt 33836486  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #66
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 164 - 215
Target Start/End: Original strand, 35532077 - 35532128
Alignment:
164 ccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgccctttt 215  Q
    ||||||||||||||||||||||||||||||||||| |||  |||||||||||    
35532077 ccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctttt 35532128  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #67
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 164 - 219
Target Start/End: Complemental strand, 40553987 - 40553932
Alignment:
164 ccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgcccttttattt 219  Q
    ||||||||||||||||||||||||||||||||||| |||  |||||||||| ||||    
40553987 ccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctttaattt 40553932  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #68
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 157 - 215
Target Start/End: Original strand, 32484311 - 32484369
Alignment:
157 tgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgccctttt 215  Q
    |||||| |||||||||||||||| |||||||||||||||||| |||  |||||||||||    
32484311 tgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgccctttt 32484369  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #69
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 64 - 201
Target Start/End: Complemental strand, 32629418 - 32629282
Alignment:
64 gttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacactaaat-gatgggac 162  Q
    ||||||||||||||  |||| |||  |||||| ||||  ||||||||||||||  |||||| |||||||||  ||||||| ||||| |||| |  |||||    
32629418 gttgtcatgtgactgaaaggtcacgggttcaaatcctcgaaacagcctcttgta-aaaaaacagggtaaggccgcctaca-tacaccaaattggcgggac 32629321  T
163 tccttcccggaccctgcgtatgcgggagctttagtgtac 201  Q
     |||||||||||| |||||||| ||||| ||||||||||    
32629320 cccttcccggaccttgcgtatgtgggagttttagtgtac 32629282  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #70
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 308 - 354
Target Start/End: Complemental strand, 41083159 - 41083113
Alignment:
308 aaataacttaaaagaccaatatgttacaaacatcaaacttaaaggac 354  Q
    |||||||||||| |||||||||||||||||| |||||||||||||||    
41083159 aaataacttaaaggaccaatatgttacaaacttcaaacttaaaggac 41083113  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #71
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 56 - 194
Target Start/End: Complemental strand, 3580994 - 3580860
Alignment:
56 gtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacactaaatg 155  Q
    ||||||||||||||||||||||  || | |||  |||||||||  ||||    |||||||||||||||  | ||||||| ||  | |||||||| |||||    
3580994 gtaaagttgttgtcatgtgactgaaaagtcacgagttcaagtctggaaa----cctcttgtgtaaaaaccatggtaaggctgtgtgcaatacaccaaatg 3580899  T
156 atgggactccttcccggaccctgcgtatgcgggagcttt 194  Q
     | |||| |||||||||||||||| |||| |||||||||    
3580898 ctaggaccccttcccggaccctgcatatgtgggagcttt 3580860  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #72
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 308 - 368
Target Start/End: Original strand, 25056188 - 25056248
Alignment:
308 aaataacttaaaagaccaatatgttacaaacatcaaacttaaaggacctctgatgtaattt 368  Q
    |||||||||||||||||||| |||||||||| ||||||||||| |||  ||| ||||||||    
25056188 aaataacttaaaagaccaatttgttacaaacctcaaacttaaaagactcctggtgtaattt 25056248  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #73
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 308 - 368
Target Start/End: Original strand, 41083346 - 41083406
Alignment:
308 aaataacttaaaagaccaatatgttacaaacatcaaacttaaaggacctctgatgtaattt 368  Q
    |||||||||||| ||||||| |||||||||| |||||||||||||||| ||  ||||||||    
41083346 aaataacttaaaggaccaatctgttacaaacctcaaacttaaaggacccctattgtaattt 41083406  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #74
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 308 - 355
Target Start/End: Complemental strand, 41083099 - 41083052
Alignment:
308 aaataacttaaaagaccaatatgttacaaacatcaaacttaaaggacc 355  Q
    |||||||||||| || ||||||||||||||| ||||||||||||||||    
41083099 aaataacttaaatgatcaatatgttacaaacctcaaacttaaaggacc 41083052  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #75
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 151 - 194
Target Start/End: Complemental strand, 47482913 - 47482870
Alignment:
151 aaatgatgggactccttcccggaccctgcgtatgcgggagcttt 194  Q
    ||||| |||||| |||||||||||||||||||||||||||||||    
47482913 aaatggtgggaccccttcccggaccctgcgtatgcgggagcttt 47482870  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #76
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 308 - 354
Target Start/End: Complemental strand, 7246097 - 7246051
Alignment:
308 aaataacttaaaagaccaatatgttacaaacatcaaacttaaaggac 354  Q
    |||||||||||| ||||||| ||||||||| ||||||||||||||||    
7246097 aaataacttaaacgaccaatttgttacaaatatcaaacttaaaggac 7246051  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #77
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 90 - 215
Target Start/End: Complemental strand, 10277879 - 10277756
Alignment:
90 gttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacactaaatgatgggactccttcccggaccctgcgtatgcggga 189  Q
    |||||| ||||  |||||||||||  |||| |||||||| ||||| ||| |||||||||| ||||| ||  || ||||||| |||||||| |||||||||    
10277879 gttcaaatccttgaaacagcctct--tgtataaaataggataaggctgcgtacaatacaccaaatggtgaaaccccttcccagaccctgcatatgcggga 10277782  T
190 gctttagtgtaccatgttgccctttt 215  Q
    | | ||||| |||   ||||||||||    
10277781 gttctagtgaaccggattgccctttt 10277756  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #78
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 152 - 214
Target Start/End: Original strand, 25388249 - 25388311
Alignment:
152 aatgatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgcccttt 214  Q
    |||| |||||| ||||||||||||||||||||||  ||||||||||| |||  ||||||||||    
25388249 aatggtgggaccccttcccggaccctgcgtatgcatgagctttagtgcaccgggttgcccttt 25388311  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #79
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 308 - 354
Target Start/End: Original strand, 45038408 - 45038454
Alignment:
308 aaataacttaaaagaccaatatgttacaaacatcaaacttaaaggac 354  Q
    |||||||||||| ||||||| |||||||||| |||||||||||||||    
45038408 aaataacttaaaggaccaatctgttacaaacctcaaacttaaaggac 45038454  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #80
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 36 - 109
Target Start/End: Complemental strand, 5313172 - 5313099
Alignment:
36 gggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagc 109  Q
    ||||||||| |||  ||||||||||||||||||||||||| |  |||| |||  |||||| |||||||||||||    
5313172 gggtaaccttggcgtaactggtaaagttgttgtcatgtgattgaaaggtcacgggttcaattcctgaaaacagc 5313099  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #81
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 308 - 353
Target Start/End: Complemental strand, 26782398 - 26782353
Alignment:
308 aaataacttaaaagaccaatatgttacaaacatcaaacttaaagga 353  Q
    |||||||||||| ||||||| ||||||||| |||||||||||||||    
26782398 aaataacttaaaggaccaatctgttacaaatatcaaacttaaagga 26782353  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #82
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 90 - 194
Target Start/End: Original strand, 36589754 - 36589859
Alignment:
90 gttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaataca-ctaaatgatgggactccttcccggaccctgcgtatgcggg 188  Q
    |||||||||||| |||||||||||||||||||||| | ||||| | ||   ||| |||| | ||||| |||||| |||||| | |||||  |||||||||    
36589754 gttcaagtcctggaaacagcctcttgtgtaaaaaacatggtaatgctgttgacagtacaccaaaatggtgggaccccttcctgaaccctatgtatgcggg 36589853  T
189 agcttt 194  Q
    ||||||    
36589854 agcttt 36589859  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #83
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 308 - 368
Target Start/End: Complemental strand, 17232033 - 17231973
Alignment:
308 aaataacttaaaagaccaatatgttacaaacatcaaacttaaaggacctctgatgtaattt 368  Q
    ||||||||||||||||  || |||||||||| |||||||||||| ||  ||||||||||||    
17232033 aaataacttaaaagacttatctgttacaaacctcaaacttaaagaactgctgatgtaattt 17231973  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #84
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 36 - 76
Target Start/End: Original strand, 18969698 - 18969738
Alignment:
36 gggtaacctcggcacaactggtaaagttgttgtcatgtgac 76  Q
    ||||||||| ||| |||||||||||||||||||||||||||    
18969698 gggtaaccttggcgcaactggtaaagttgttgtcatgtgac 18969738  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #85
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 308 - 368
Target Start/End: Original strand, 26782525 - 26782585
Alignment:
308 aaataacttaaaagaccaatatgttacaaacatcaaacttaaaggacctctgatgtaattt 368  Q
    ||||||||||||| | |||||| |||||||| |||||||||||||||| |  |||||||||    
26782525 aaataacttaaaaaatcaatatattacaaacctcaaacttaaaggaccccaaatgtaattt 26782585  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #86
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 55 - 123
Target Start/End: Complemental strand, 42164307 - 42164239
Alignment:
55 ggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaa 123  Q
    |||||| ||||||||||||||||  |||| |||  ||||||||| || ||||| |||||||||||||||    
42164307 ggtaaaattgttgtcatgtgactgaaaggtcacgggttcaagtcttggaaacaacctcttgtgtaaaaa 42164239  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #87
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 308 - 368
Target Start/End: Complemental strand, 45038234 - 45038174
Alignment:
308 aaataacttaaaagaccaatatgttacaaacatcaaacttaaaggacctctgatgtaattt 368  Q
    ||||||||||||||| |||||| |||||||| |||||||||||| |||   ||||||||||    
45038234 aaataacttaaaagatcaatatattacaaacctcaaacttaaagaaccctggatgtaattt 45038174  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #88
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 308 - 368
Target Start/End: Complemental strand, 45787068 - 45787008
Alignment:
308 aaataacttaaaagaccaatatgttacaaacatcaaacttaaaggacctctgatgtaattt 368  Q
    |||||||||||||| | | |||||||||||  |||||||||||||||||||| | ||||||    
45787068 aaataacttaaaagcctagtatgttacaaagctcaaacttaaaggacctctggtttaattt 45787008  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #89
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 308 - 352
Target Start/End: Original strand, 55617583 - 55617627
Alignment:
308 aaataacttaaaagaccaatatgttacaaacatcaaacttaaagg 352  Q
    |||||||||||||||| |||||||| ||||| |||||||||||||    
55617583 aaataacttaaaagacaaatatgttgcaaacctcaaacttaaagg 55617627  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #90
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 308 - 352
Target Start/End: Original strand, 55624887 - 55624931
Alignment:
308 aaataacttaaaagaccaatatgttacaaacatcaaacttaaagg 352  Q
    |||||||||||||||| |||||||| ||||| |||||||||||||    
55624887 aaataacttaaaagacaaatatgttgcaaacctcaaacttaaagg 55624931  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #91
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 111 - 213
Target Start/End: Complemental strand, 12711553 - 12711450
Alignment:
111 tcttgtgtaaaaaa-tagggtaaggttgcctacaatacactaaatgatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgc 209  Q
    |||||||||||||| |||||||||  ||| |||||||||| |||||  ||||| ||||| | ||||  |||||||||| | |||||||| |||  |||||    
12711553 tcttgtgtaaaaaaatagggtaagactgcgtacaatacaccaaatggcgggaccccttctcagacctagcgtatgcggaaactttagtgcacccagttgc 12711454  T
210 cctt 213  Q
    ||||    
12711453 cctt 12711450  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #92
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 1 - 32
Target Start/End: Original strand, 14983673 - 14983704
Alignment:
1 attcccaccattaatttcttttcaatgacttt 32  Q
    ||||||||||||||||||||||||||||||||    
14983673 attcccaccattaatttcttttcaatgacttt 14983704  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #93
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 308 - 355
Target Start/End: Original strand, 24684337 - 24684384
Alignment:
308 aaataacttaaaagaccaatatgttacaaacatcaaacttaaaggacc 355  Q
    |||||||||||||||||||| | ||| |||| ||||||||||||||||    
24684337 aaataacttaaaagaccaatctattataaacctcaaacttaaaggacc 24684384  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #94
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 32 - 83
Target Start/End: Complemental strand, 29879679 - 29879628
Alignment:
32 tgaggggtaacctcggcacaactggtaaagttgttgtcatgtgactagaagg 83  Q
    ||||||||||| | ||  |||||| |||||||||||||||||||||||||||    
29879679 tgaggggtaacattggtgcaactgataaagttgttgtcatgtgactagaagg 29879628  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #95
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 307 - 350
Target Start/End: Original strand, 41083285 - 41083328
Alignment:
307 gaaataacttaaaagaccaatatgttacaaacatcaaacttaaa 350  Q
    ||||||||||||||||||||| |||||| ||| |||||||||||    
41083285 gaaataacttaaaagaccaatctgttacgaacctcaaacttaaa 41083328  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #96
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 308 - 355
Target Start/End: Original strand, 41519445 - 41519492
Alignment:
308 aaataacttaaaagaccaatatgttacaaacatcaaacttaaaggacc 355  Q
    |||||||||||||||| ||| ||||| |||| ||||||||||||||||    
41519445 aaataacttaaaagactaatttgttagaaacctcaaacttaaaggacc 41519492  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #97
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 55 - 134
Target Start/End: Original strand, 43035224 - 43035303
Alignment:
55 ggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaagg 134  Q
    |||||||||||||||| ||||||  |||| |||  |||||||||| | ||||| |||||||||||| ||| | |||||||    
43035224 ggtaaagttgttgtcacgtgactgaaaggtcacgggttcaagtccaggaaacaacctcttgtgtaagaaacacggtaagg 43035303  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #98
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 157 - 196
Target Start/End: Original strand, 44718645 - 44718684
Alignment:
157 tgggactccttcccggaccctgcgtatgcgggagctttag 196  Q
    |||||| ||||||| |||||||||||||||||||||||||    
44718645 tgggaccccttcccagaccctgcgtatgcgggagctttag 44718684  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #99
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 321 - 368
Target Start/End: Original strand, 51950784 - 51950831
Alignment:
321 gaccaatatgttacaaacatcaaacttaaaggacctctgatgtaattt 368  Q
    ||||||| | |||||||| ||||||||||||||| |||||||||||||    
51950784 gaccaatctattacaaacttcaaacttaaaggacttctgatgtaattt 51950831  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #100
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 308 - 354
Target Start/End: Original strand, 2470140 - 2470186
Alignment:
308 aaataacttaaaagaccaatatgttacaaacatcaaacttaaaggac 354  Q
    |||||||||||| ||||||||| |||||||| ||||| |||||||||    
2470140 aaataacttaaaggaccaatatattacaaacctcaaatttaaaggac 2470186  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #101
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 308 - 350
Target Start/End: Original strand, 9999522 - 9999564
Alignment:
308 aaataacttaaaagaccaatatgttacaaacatcaaacttaaa 350  Q
    |||||||||||| ||||||| |||||||||| |||||||||||    
9999522 aaataacttaaatgaccaatctgttacaaacctcaaacttaaa 9999564  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #102
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 157 - 215
Target Start/End: Original strand, 19027989 - 19028047
Alignment:
157 tgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgccctttt 215  Q
    ||||||||||||||||||||  | |||||||||||||||||| |||  | |||||||||    
19027989 tgggactccttcccggaccccacttatgcgggagctttagtgcaccgggctgccctttt 19028047  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #103
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 308 - 354
Target Start/End: Original strand, 21322062 - 21322108
Alignment:
308 aaataacttaaaagaccaatatgttacaaacatcaaacttaaaggac 354  Q
    |||||||||||||||  ||| |||||||||| |||||||||||||||    
21322062 aaataacttaaaagaaaaatgtgttacaaacctcaaacttaaaggac 21322108  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #104
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 165 - 203
Target Start/End: Complemental strand, 37038172 - 37038134
Alignment:
165 cttcccggaccctgcgtatgcgggagctttagtgtacca 203  Q
    ||||||| |||||||||||||||||||||||||| ||||    
37038172 cttcccgtaccctgcgtatgcgggagctttagtgcacca 37038134  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #105
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 308 - 354
Target Start/End: Complemental strand, 40395204 - 40395158
Alignment:
308 aaataacttaaaagaccaatatgttacaaacatcaaacttaaaggac 354  Q
    ||||||||||||  || |||||||||||||| |||||||||||||||    
40395204 aaataacttaaagaactaatatgttacaaacctcaaacttaaaggac 40395158  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #106
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 308 - 354
Target Start/End: Complemental strand, 46196215 - 46196169
Alignment:
308 aaataacttaaaagaccaatatgttacaaacatcaaacttaaaggac 354  Q
    ||||| |||||| ||||||| |||||||||| |||||||||||||||    
46196215 aaatatcttaaaggaccaatttgttacaaacgtcaaacttaaaggac 46196169  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #107
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 308 - 353
Target Start/End: Original strand, 45038468 - 45038513
Alignment:
308 aaataacttaaaagaccaatatgttacaaacatcaaacttaaagga 353  Q
    |||||||||||| ||||||| | |||||||| ||||||||||||||    
45038468 aaataacttaaatgaccaatctattacaaacctcaaacttaaagga 45038513  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #108
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 55 - 124
Target Start/End: Complemental strand, 54640498 - 54640429
Alignment:
55 ggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaa 124  Q
    |||||| ||||||||| ||| ||  |||| |||  ||||||||| || ||||||||||||||||||||||    
54640498 ggtaaaattgttgtcacgtggctgaaaggtcacgggttcaagtcttggaaacagcctcttgtgtaaaaaa 54640429  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #109
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 308 - 368
Target Start/End: Original strand, 2470200 - 2470260
Alignment:
308 aaataacttaaaagaccaatatgttacaaacatcaaacttaaaggacctctgatgtaattt 368  Q
    |||||||||||| ||||||| | |||||||| | ||||| |||||||| ||| ||||||||    
2470200 aaataacttaaaggaccaatctattacaaaccttaaactgaaaggacccctggtgtaattt 2470260  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #110
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 308 - 368
Target Start/End: Complemental strand, 7246037 - 7245977
Alignment:
308 aaataacttaaaagaccaatatgttacaaacatcaaacttaaaggacctctgatgtaattt 368  Q
    |||||||||||| || |||  |||||||||| |||||||||||||||| | | ||||||||    
7246037 aaataacttaaaggatcaacctgttacaaacgtcaaacttaaaggaccccaggtgtaattt 7245977  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #111
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 70 - 154
Target Start/End: Complemental strand, 10380086 - 10380003
Alignment:
70 atgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacactaaat 154  Q
    ||||||||  |||| ||| ||||||||||||  ||||| ||||||||||| |||||||| |||  |||| |||||||||| ||||    
10380086 atgtgactgaaaggtcacttgttcaagtcctacaaacaacctcttgtgta-aaaataggataaaattgcgtacaatacaccaaat 10380003  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #112
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 310 - 354
Target Start/End: Original strand, 12592424 - 12592468
Alignment:
310 ataacttaaaagaccaatatgttacaaacatcaaacttaaaggac 354  Q
    ||||||||||||| |||| | |||||||| |||||||||||||||    
12592424 ataacttaaaagatcaatctattacaaacttcaaacttaaaggac 12592468  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #113
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 121 - 202
Target Start/End: Original strand, 16494259 - 16494342
Alignment:
121 aaaatagggtaaggttgcctacaatacactaaa--tgatgggactccttcccggaccctgcgtatgcgggagctttagtgtacc 202  Q
    |||| ||||||| | ||| |||||||||| |||  || |||||| | ||||| ||||||| |||||||| ||||||||||||||    
16494259 aaaacagggtaaagctgcatacaatacaccaaaaatggtgggaccctttcccagaccctgtgtatgcggaagctttagtgtacc 16494342  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #114
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 57 - 129
Target Start/End: Complemental strand, 23580365 - 23580293
Alignment:
57 taaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaataggg 129  Q
    |||||||||||||| ||||||  |||| |||  |||||||| ||  ||| |||||||||||||||||| ||||    
23580365 taaagttgttgtcacgtgactgaaaggtcacgggttcaagttctagaaagagcctcttgtgtaaaaaacaggg 23580293  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #115
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 308 - 368
Target Start/End: Original strand, 53863611 - 53863671
Alignment:
308 aaataacttaaaagaccaatatgttacaaacatcaaacttaaaggacctctgatgtaattt 368  Q
    |||||||||||| ||||||| | |||||||| | |||||||||||||   |||||||||||    
53863611 aaataacttaaacgaccaatctattacaaacttgaaacttaaaggactcatgatgtaattt 53863671  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 117; Significance: 2e-59; HSPs: 71)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 117; E-Value: 2e-59
Query Start/End: Original strand, 30 - 218
Target Start/End: Original strand, 36720747 - 36720935
Alignment:
30 tttgaggggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaataggg 129  Q
    ||||||||||||||| |||  ||||||||||||||||||||||||||| ||||| |||  |||||||||||| |||||||||||||||||||||| ||||    
36720747 tttgaggggtaaccttggcgtaactggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacaggg 36720846  T
130 taaggttgcctacaatacactaaatgatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgcccttttatt 218  Q
    ||||| ||| |||||||||| ||||| |||||| |||||||||||||||||||||||| |||||||||| |||  ||||||||||||||    
36720847 taaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgcggaagctttagtgcacccggttgcccttttatt 36720935  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 111; E-Value: 7e-56
Query Start/End: Original strand, 33 - 215
Target Start/End: Original strand, 35261633 - 35261815
Alignment:
33 gaggggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaa 132  Q
    |||||||||||| ||| |||||||||||||||||||||||||||| ||||| |||  ||||||| |||| |||||| ||||||||||||||| |||||||    
35261633 gaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactggaaggtcacgggttcaagccctggaaacagtctcttgtgtaaaaaacagggtaa 35261732  T
133 ggttgcctacaatacactaaatgatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgccctttt 215  Q
    |||||| |||||||||| ||||| |||||| |||||| |||||||||||||||||||||||||||| |||  |||||||||||    
35261733 ggttgcgtacaatacaccaaatggtgggaccccttcctggaccctgcgtatgcgggagctttagtgcaccgggttgccctttt 35261815  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 110; E-Value: 3e-55
Query Start/End: Original strand, 30 - 215
Target Start/End: Complemental strand, 28817810 - 28817625
Alignment:
30 tttgaggggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaataggg 129  Q
    ||||||||||||||| ||  |||||||||||||||||||||||||||| ||||| |||  |||||||||||| |||||||||||||||||||||| ||||    
28817810 tttgaggggtaaccttggtgcaactggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacaggg 28817711  T
130 taaggttgcctacaatacactaaatgatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgccctttt 215  Q
    ||||| ||| ||||||||||  |||| |||||| ||||||||||||||||||||||||||||||||||| | |  |||||||||||    
28817710 taaggctgcgtacaatacacccaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcatcgggttgccctttt 28817625  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 105; E-Value: 3e-52
Query Start/End: Original strand, 33 - 217
Target Start/End: Original strand, 44530103 - 44530287
Alignment:
33 gaggggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaa 132  Q
    |||||||||||| ||| ||||||||||||||| |||||||||||||||||| |||  ||||||||| || ||||| |||||||||||||||| |||||||    
44530103 gaggggtaaccttggcgcaactggtaaagttgctgtcatgtgactagaaggtcacgggttcaagtcttggaaacaacctcttgtgtaaaaaacagggtaa 44530202  T
133 ggttgcctacaatacactaaatgatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgcccttttat 217  Q
    || ||| |||||||||| ||||| |||||| |||||| |||||||||||||||||||||||||||| |||  |||| ||||||||    
44530203 ggctgcgtacaatacaccaaatggtgggaccccttcctggaccctgcgtatgcgggagctttagtgcaccgggttgaccttttat 44530287  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 99; E-Value: 1e-48
Query Start/End: Original strand, 32 - 198
Target Start/End: Original strand, 13160655 - 13160820
Alignment:
32 tgaggggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggta 131  Q
    ||||||||||||||||| ||||||||||||||||||||||||||||  |||| |||  |||||||||||  |||||||||||||||| ||||| ||||||    
13160655 tgaggggtaacctcggcgcaactggtaaagttgttgtcatgtgactgtaaggtcacgggttcaagtcctagaaacagcctcttgtgt-aaaaacagggta 13160753  T
132 aggttgcctacaatacactaaatgatgggactccttcccggaccctgcgtatgcgggagctttagtg 198  Q
    ||| ||| |||||||||| ||||| |||||| |||||||||||||||||||||||||||||| ||||    
13160754 aggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgcgggagcttcagtg 13160820  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 99; E-Value: 1e-48
Query Start/End: Original strand, 32 - 215
Target Start/End: Original strand, 25250475 - 25250660
Alignment:
32 tgaggggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggta 131  Q
    |||| |||||||| |||||||||||||||||||||||||||||||| ||||| ||||||||||||||||| ||||||||| |||||||||||||||||||    
25250475 tgagaggtaaccttggcacaactggtaaagttgttgtcatgtgactggaaggtcacatgttcaagtcctggaaacagcctattgtgtaaaaaatagggta 25250574  T
132 aggttgcctacaatacacta--aatgatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgccctttt 215  Q
     || ||| |||||||||| |  |||| |||||| |||||||| |||| || |||||||||| ||||||| |||  |||||||||||    
25250575 tggctgcgtacaatacaccaataatggtgggaccccttcccgaaccccgcatatgcgggagatttagtgcaccgggttgccctttt 25250660  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 97; E-Value: 2e-47
Query Start/End: Original strand, 32 - 217
Target Start/End: Complemental strand, 39461178 - 39460991
Alignment:
32 tgaggggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggta 131  Q
    ||||||||||||| ||| ||||||||||||||||||||||| ||||  |||| |||  |||||||||||| |||||||||||||||||||||| || |||    
39461178 tgaggggtaaccttggcgcaactggtaaagttgttgtcatgagactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagagta 39461079  T
132 aggttgcctacaatacacta--aatgatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgcccttttat 217  Q
    ||| ||| |||||||||| |  |||| || ||| ||||||||||||||||||||||||||||||||||| |||  |||||||||||||    
39461078 aggctgcgtacaatacaccaataatggtgagaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttttat 39460991  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #8
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 33 - 215
Target Start/End: Complemental strand, 12670429 - 12670249
Alignment:
33 gaggggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaa 132  Q
    |||||||||||| ||| ||||||||||||||||||||||||||||  |||| |||  |||||||||||| ||||||||||||||||  |||| |||||||    
12670429 gaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgt--aaaacagggtaa 12670332  T
133 ggttgcctacaatacactaaatgatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgccctttt 215  Q
    || ||| |||||||||| ||||| |||||| |||||||||||||||| |||||||||||| ||||| |||  ||| |||||||    
12670331 ggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttaccctttt 12670249  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #9
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 33 - 198
Target Start/End: Complemental strand, 29521866 - 29521701
Alignment:
33 gaggggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaa 132  Q
    |||||||||||| ||| |||||| ||||||||||||| ||||||| ||||| |||  |||||||||||| |||||||||||||| ||||||| |||||||    
29521866 gaggggtaaccttggcgcaactgataaagttgttgtcgtgtgactggaaggtcacgggttcaagtcctggaaacagcctcttgtttaaaaaacagggtaa 29521767  T
133 ggttgcctacaatacactaaatgatgggactccttcccggaccctgcgtatgcgggagctttagtg 198  Q
    || ||| |||||||||| ||||| |||||  || |||| |||||||||||||||||||||||||||    
29521766 ggctgcgtacaatacaccaaatggtgggaacccatcccagaccctgcgtatgcgggagctttagtg 29521701  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #10
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 31 - 215
Target Start/End: Complemental strand, 30454278 - 30454096
Alignment:
31 ttgaggggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggt 130  Q
    |||||||||||||| ||| ||||||||||||||||||||||||||||  |||| |||  |||||||||||| ||||||||||||||||  |||| | |||    
30454278 ttgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgt--aaaacaaggt 30454181  T
131 aaggttgcctacaatacactaaatgatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgccctttt 215  Q
    |||| ||| ||| |||||| ||||| |||||| |||||||||||||||| |||||||||||| ||||| |||  |||||||||||    
30454180 aaggctgcgtacgatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctttt 30454096  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #11
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 32 - 215
Target Start/End: Original strand, 6760776 - 6760960
Alignment:
32 tgaggggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggta 131  Q
    ||||||||||| | ||| |||||||||||||||||||||| ||||||||||| |||  |||||||||||| |||||||||||||||||||||| ||||||    
6760776 tgaggggtaactt-ggcgcaactggtaaagttgttgtcatatgactagaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggta 6760874  T
132 aggttgcctacaatacacta--aatgatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgccctttt 215  Q
    ||| | | |||||||||| |  |||| |||||| ||||| ||||||| || |||||||||||||||||| |||  |||||||||||    
6760875 aggcttcgtacaatacaccaataatggtgggaccccttctcggaccccgcatatgcgggagctttagtgcaccgggttgccctttt 6760960  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #12
Raw Score: 86; E-Value: 6e-41
Query Start/End: Original strand, 33 - 215
Target Start/End: Complemental strand, 7136710 - 7136526
Alignment:
33 gaggggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaa 132  Q
    |||||||||||| ||| |||||||||||||||||||||||||||| ||||| ||   |||||||||||| ||||| |||||||||||||||  |||||||    
7136710 gaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactggaaggtcatgggttcaagtcctggaaacaacctcttgtgtaaaaaccagggtaa 7136611  T
133 ggttgcctacaatacacta--aatgatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgccctttt 215  Q
    || ||| |||||||||| |  |||| |||||| ||||||||||||| || |||||||||||||||||| |||  ||| |||||||    
7136610 ggctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccgggttaccctttt 7136526  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #13
Raw Score: 86; E-Value: 6e-41
Query Start/End: Original strand, 46 - 215
Target Start/End: Complemental strand, 8897932 - 8897763
Alignment:
46 ggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaat 145  Q
    |||||||||||||||||||||||||||||||   |||| |||  ||| |||||||| ||||| || ||||||||||||||||||||||| | | ||||||    
8897932 ggcacaactggtaaagttgttgtcatgtgacagcaaggtcacgggttgaagtcctggaaacaaccgcttgtgtaaaaaatagggtaaggctacgtacaat 8897833  T
146 acactaaatgatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgccctttt 215  Q
    |||| ||||| |||||| |||||||||||||||| ||||||||||||||| || |||  |||||||||||    
8897832 acaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttactgcacccggttgccctttt 8897763  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #14
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 31 - 215
Target Start/End: Complemental strand, 18164942 - 18164759
Alignment:
31 ttgaggggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggt 130  Q
    ||||||||||| || ||| |||| ||| |||||||||||||||||||  |||| |||  |||||||||||| ||||||||||||||||| |||| |||||    
18164942 ttgaggggtaatcttggcgcaaccggtgaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgta-aaaacagggt 18164844  T
131 aaggttgcctacaatacactaaatgatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgccctttt 215  Q
    |||||||| |||||||||| ||| |||| |||   ||||||||||||||||||||||||||||||||| |||  |||||| ||||    
18164843 aaggttgcgtacaatacaccaaaggatgtgaccatttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccatttt 18164759  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #15
Raw Score: 84; E-Value: 9e-40
Query Start/End: Original strand, 32 - 214
Target Start/End: Original strand, 2626472 - 2626657
Alignment:
32 tgaggggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgt---aaaaaatagg 128  Q
    ||||||||||||| ||| ||| |||||||||||||||||||||||   |||| |||  |||||||||||| ||||||||||||||||   |||||| |||    
2626472 tgaggggtaaccttggcgcaattggtaaagttgttgtcatgtgaccgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaaaaacagg 2626571  T
129 gtaaggttgcctacaatacactaaatgatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgcccttt 214  Q
    |||||  ||| |||||||||| |||||||||||| ||||||| |||||||| ||||||||||||| |||| ||||  |||||||||    
2626572 gtaagactgcgtacaatacaccaaatgatgggaccccttcccagaccctgcatatgcgggagcttcagtgcaccagattgcccttt 2626657  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #16
Raw Score: 81; E-Value: 5e-38
Query Start/End: Original strand, 33 - 213
Target Start/End: Original strand, 45071219 - 45071398
Alignment:
33 gaggggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaa 132  Q
    |||||||||||| |||   |||||||||||||||||||||||| |  |||| |||  |||||||| ||| |||||||||||||||||||||  |||||||    
45071219 gaggggtaaccttggcgatactggtaaagttgttgtcatgtgattgtaaggtcacgggttcaagttctggaaacagcctcttgtgtaaaaac-agggtaa 45071317  T
133 ggttgcctacaatacactaaatgatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgccctt 213  Q
    || ||| |||||||||| ||||| |||||| |||||||||||| ||||||||||||||||| |||| |||  |||||||||    
45071318 ggctgcgtacaatacaccaaatggtgggaccccttcccggaccttgcgtatgcgggagcttcagtgcaccgggttgccctt 45071398  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #17
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 50 - 216
Target Start/End: Original strand, 12625860 - 12626027
Alignment:
50 caactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaat-agggtaaggttgcctacaataca 148  Q
    |||||||||||||||||||| ||||||| | ||| |||  | |||||||||| ||||| ||||||||||||||||  ||||||||  ||| |||||||||    
12625860 caactggtaaagttgttgtcgtgtgacttgtaggtcacgggctcaagtcctggaaacaacctcttgtgtaaaaaaacagggtaagactgcatacaataca 12625959  T
149 ctaaatgatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgccctttta 216  Q
    | ||||| |||||| || |||||||||||||||||||||||||||||||| |||  ||||||||||||    
12625960 ccaaatggtgggaccccctcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctttta 12626027  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #18
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 30 - 214
Target Start/End: Original strand, 17823527 - 17823711
Alignment:
30 tttgaggggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaataggg 129  Q
    |||||||||||| || ||| |||||||||||||||||||||||||||   |||| |||  |||||||||||| |||||||||||||||||||||  |||     
17823527 tttgaggggtaatcttggcgcaactggtaaagttgttgtcatgtgaccgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaccagga 17823626  T
130 taaggttgcctacaatacactaaatgatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgcccttt 214  Q
    ||||  ||| || ||||||| ||||| ||| || |||||||| ||||||| ||||| |||||||||||| |||  ||||||||||    
17823627 taagactgcgtaaaatacaccaaatggtggaaccccttcccgaaccctgcatatgcaggagctttagtgcaccgggttgcccttt 17823711  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #19
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 24 - 198
Target Start/End: Complemental strand, 20284263 - 20284085
Alignment:
24 aatgactttgaggggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgt--aaa 121  Q
    ||||| || ||| |||||||| | | |||| |||||||||||||||||||||||  |||| |||  |||||||||||| |||||||||||||| |  |||    
20284263 aatgaattagagcggtaaccttgacgcaacgggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtataaaaa 20284164  T
122 aaatagggtaaggttgcctacaatacacta--aatgatgggactccttcccggaccctgcgtatgcgggagctttagtg 198  Q
    ||| ||||||||| ||| |||||||||| |  |||| |||||| ||||||||||||||||||||||||||| |||||||    
20284163 aaaaagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccctgcgtatgcgggagttttagtg 20284085  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #20
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 56 - 194
Target Start/End: Complemental strand, 24365218 - 24365079
Alignment:
56 gtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaat-agggtaaggttgcctacaatacactaaat 154  Q
    ||||||||||||||||||||||| || | |||  ||||||| |||  ||||||||||||||||||||||| ||||||||| |||  ||||||||| ||||    
24365218 gtaaagttgttgtcatgtgactaaaatgtcacgggttcaagccctagaaacagcctcttgtgtaaaaaatcagggtaaggctgcgaacaatacaccaaat 24365119  T
155 gatgggactccttcccggaccctgcgtatgcgggagcttt 194  Q
    | |||||| ||||||||||||||||||||| |||||||||    
24365118 ggtgggaccccttcccggaccctgcgtatgtgggagcttt 24365079  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #21
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 33 - 216
Target Start/End: Original strand, 26954086 - 26954272
Alignment:
33 gaggggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgt-aaaaaatagggta 131  Q
    |||||||||| | |||  || |||||||||||||||||||||| ||||||| |||  |||||||||||| |||||||||||||||| |||||| ||||||    
26954086 gaggggtaactttggcgtaattggtaaagttgttgtcatgtgattagaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaaacagggta 26954185  T
132 aggttgcctacaatacacta--aatgatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgccctttta 216  Q
    ||| ||| |||||||||| |  |||| |||||| ||||||| ||||  || |||||||||||||||||| ||   ||||||||||||    
26954186 aggctgcgtacaatacaccaataatggtgggaccccttcccagacctcgcatatgcgggagctttagtgcactgggttgccctttta 26954272  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #22
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 24 - 198
Target Start/End: Complemental strand, 21070892 - 21070713
Alignment:
24 aatgactttgaggggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgt---aa 120  Q
    ||||| || ||| |||||||| | | |||| |||||||||||||||||||||||  |||| |||  |||||||||||| |||||||||||||| |   ||    
21070892 aatgaattagagcggtaaccttgacgcaacgggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtataaaaa 21070793  T
121 aaaatagggtaaggttgcctacaatacacta--aatgatgggactccttcccggaccctgcgtatgcgggagctttagtg 198  Q
    |||| ||||||||| ||| |||||||||| |  |||| |||||| ||||||||||||||||||||||||||| |||||||    
21070792 aaaaaagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccctgcgtatgcgggagttttagtg 21070713  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #23
Raw Score: 69; E-Value: 8e-31
Query Start/End: Original strand, 90 - 194
Target Start/End: Complemental strand, 5135413 - 5135309
Alignment:
90 gttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacactaaatgatgggactccttcccggaccctgcgtatgcggga 189  Q
    |||||||||||| |||||||||||||||||||||| ||||||||| ||  |||||||||| ||||| |||||| |||||||||||||||||||||| |||    
5135413 gttcaagtcctggaaacagcctcttgtgtaaaaaagagggtaaggctgtgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgcagga 5135314  T
190 gcttt 194  Q
    |||||    
5135313 gcttt 5135309  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #24
Raw Score: 69; E-Value: 8e-31
Query Start/End: Original strand, 96 - 212
Target Start/End: Original strand, 29877111 - 29877227
Alignment:
96 gtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacactaaatgatgggactccttcccggaccctgcgtatgcgggagcttta 195  Q
    |||||| ||||||||| |||||||||||| ||||||||| ||| |||||||||| ||||| |||||| |||||||||||||||||||||||||||| |||    
29877111 gtcctggaaacagccttttgtgtaaaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgcgggagcgtta 29877210  T
196 gtgtaccatgttgccct 212  Q
    ||| |||| | ||||||    
29877211 gtgcaccaggctgccct 29877227  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #25
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 33 - 191
Target Start/End: Complemental strand, 20869677 - 20869523
Alignment:
33 gaggggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaa 132  Q
    ||||| |||||| ||| ||||||||||||||||||||||||||||  |||| |||  |||||||||||| ||||||||||||||||  |||| |||||||    
20869677 gagggataaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgt--aaaacagggtaa 20869580  T
133 ggttgcctacaatacactaaatgatgggactccttcccggaccctgcgtatgcgggagc 191  Q
    || ||  |||||||||| ||  | || ||| |||||||||||||||| |||||||||||    
20869579 ggctgtgtacaatacaccaa--ggtgagaccccttcccggaccctgcatatgcgggagc 20869523  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #26
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 90 - 198
Target Start/End: Original strand, 389654 - 389764
Alignment:
90 gttcaagtcctgaaaacagcctcttgtgt--aaaaaatagggtaaggttgcctacaatacactaaatgatgggactccttcccggaccctgcgtatgcgg 187  Q
    |||||||||||| ||||| ||||||||||  |||||| ||||||||||||| |||||||||| |||||||||||  |||| || |||||||||||||||     
389654 gttcaagtcctggaaacaccctcttgtgtcaaaaaaacagggtaaggttgcgtacaatacaccaaatgatgggatccctttcctgaccctgcgtatgcga 389753  T
188 gagctttagtg 198  Q
    |||||||||||    
389754 gagctttagtg 389764  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #27
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 50 - 214
Target Start/End: Original strand, 28407387 - 28407538
Alignment:
50 caactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacac 149  Q
    |||||||||||||||||||||||||||| ||||| |||  |||||||||||| |||||||||||||||| ||||| |||||||||            |||    
28407387 caactggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaacagcctcttgtgt-aaaaacagggtaagg------------cac 28407473  T
150 taaatgatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgcccttt 214  Q
     ||||| |||||| |||||||||||||| ||||||||||||||||| || |||  ||||||||||    
28407474 caaatggtgggaccccttcccggaccctacgtatgcgggagctttactgcaccgggttgcccttt 28407538  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #28
Raw Score: 59; E-Value: 7e-25
Query Start/End: Original strand, 90 - 196
Target Start/End: Complemental strand, 8484062 - 8483956
Alignment:
90 gttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacactaaatgatgggactccttcccggaccctgcgtatgcggga 189  Q
    |||||||||||| ||||| |||||||||||||||| |||| |||| ||| |||||||||| || || |||||| || |||| ||||||||||||||||||    
8484062 gttcaagtcctggaaacaacctcttgtgtaaaaaacagggcaaggctgcgtacaatacaccaattggtgggaccccatcccagaccctgcgtatgcggga 8483963  T
190 gctttag 196  Q
    |||||||    
8483962 gctttag 8483956  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #29
Raw Score: 59; E-Value: 7e-25
Query Start/End: Original strand, 55 - 198
Target Start/End: Complemental strand, 44781665 - 44781520
Alignment:
55 ggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacactaaa- 153  Q
    |||||||||||||||| ||||||  |||  |||  |||||||||||| ||||| |||||||||||||| | ||||||||| ||  |||||||||| |||     
44781665 ggtaaagttgttgtcacgtgactgaaagttcacgggttcaagtcctggaaacaacctcttgtgtaaaagacagggtaaggctgtgtacaatacaccaaaa 44781566  T
154 -tgatgggactccttcccggaccctgcgtatgcgggagctttagtg 198  Q
     || |||||| || |||| |||||||||||||||||||||||||||    
44781565 atgttgggaccccgtcccagaccctgcgtatgcgggagctttagtg 44781520  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #30
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 32 - 216
Target Start/End: Complemental strand, 40605087 - 40604904
Alignment:
32 tgaggggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggta 131  Q
    ||||||||||| | ||| |||||||||||||||||||||||||| | || |   |   ||||||||| || |||||  || ||||||||||||| || ||    
40605087 tgaggggtaactttggcgcaactggtaaagttgttgtcatgtgattggatgattatgggttcaagtcatggaaacaatcttttgtgtaaaaaattggata 40604988  T
132 aggttgcctacaatacactaaatgatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgccctttta 216  Q
    ||||||| |||||||||||||||||| |||  ||||||   ||||| |||||||||||||||||||| |||   |||||||||||    
40604987 aggttgcgtacaatacactaaatgat-ggatcccttccgaaaccctacgtatgcgggagctttagtgcaccgaattgccctttta 40604904  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #31
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 97 - 215
Target Start/End: Original strand, 20869941 - 20870061
Alignment:
97 tcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacacta--aatgatgggactccttcccggaccctgcgtatgcgggagcttt 194  Q
    ||||| |||||| ||||||||||||||| ||||||||| ||| |||||||||| |  |||| |||||| |||||| |||||| || ||||||||||||||    
20869941 tcctggaaacagtctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttccaggaccccgcatatgcgggagcttt 20870040  T
195 agtgtaccatgttgccctttt 215  Q
    |||| |||  |||||||||||    
20870041 agtgcaccgggttgccctttt 20870061  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #32
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 90 - 198
Target Start/End: Original strand, 5689642 - 5689750
Alignment:
90 gttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacactaaatgatgggactccttcccggaccctgcgtatgcggga 189  Q
    ||||||||| || ||| |||||||||||||||||  ||||||||| ||| |||||||||| ||||| ||| || |||||||| ||| |||||||| ||||    
5689642 gttcaagtcttgtaaatagcctcttgtgtaaaaagcagggtaaggctgcgtacaatacaccaaatggtggaaccccttcccgaaccatgcgtatgtggga 5689741  T
190 gctttagtg 198  Q
    |||||||||    
5689742 gctttagtg 5689750  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #33
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 61 - 217
Target Start/End: Original strand, 31457155 - 31457310
Alignment:
61 gttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacactaaatgatggg 160  Q
    |||||||||||||| ||  |||| |||  |||||||||||| ||||| ||||||||||||||| ||||  |||| ||| |||||||||  ||||| | ||    
31457155 gttgttgtcatgtggctgaaaggtcacgggttcaagtcctgtaaacaacctcttgtgtaaaaa-taggaaaaggctgcgtacaatacatcaaatggtagg 31457253  T
161 actccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgcccttttat 217  Q
    || |||||||  |||||||||||||||||||| ||||| |||   ||||||||||||    
31457254 accccttcccaaaccctgcgtatgcgggagctctagtgcaccggattgcccttttat 31457310  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #34
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 55 - 203
Target Start/End: Original strand, 22598133 - 22598280
Alignment:
55 ggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacactaaat 154  Q
    ||||||||||||||||  |||||  |||| |||  |||||| ||||| ||||| |||||||||||||||| ||||||||| |   |||||||||| || |    
22598133 ggtaaagttgttgtcacatgactgaaaggtcacgggttcaaatcctggaaacaacctcttgtgtaaaaaacagggtaaggctatgtacaatacaccaatt 22598232  T
155 gatgggactccttcccggaccctgcgtatgcgggagctttagtgtacca 203  Q
    | || ||| | |||||||||| ||||||||||||| |||||||| ||||    
22598233 ggtgagaccctttcccggaccttgcgtatgcggga-ctttagtgcacca 22598280  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #35
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 55 - 198
Target Start/End: Complemental strand, 42083858 - 42083714
Alignment:
55 ggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaataca-ctaaa 153  Q
    |||||| ||||||||| ||||||  |||| |||  |||||||||||| ||||||||| ||||||||||||| ||| |||| ||| |||| || | | |||    
42083858 ggtaaaattgttgtcacgtgactgaaaggtcacgggttcaagtcctggaaacagccttttgtgtaaaaaatggggcaaggctgcgtacagtataccaaaa 42083759  T
154 tgatgggactccttcccggaccctgcgtatgcgggagctttagtg 198  Q
    || |||||| |||||||| |||||| ||| | |||||||||||||    
42083758 tggtgggaccccttcccgaaccctgtgtacgtgggagctttagtg 42083714  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #36
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 103 - 215
Target Start/End: Original strand, 10857852 - 10857965
Alignment:
103 aaacagcctcttgtgtaaaaaat-agggtaaggttgcctacaatacactaaatgatgggactccttcccggaccctgcgtatgcgggagctttagtgtac 201  Q
    |||| |||||||||||||||||  ||||||||| |||  ||||||||| || || ||||||  ||||| ||||| |||||||||||||||||||||| ||    
10857852 aaaccgcctcttgtgtaaaaaaacagggtaaggctgcgcacaatacaccaattggtgggaccacttcctggaccttgcgtatgcgggagctttagtgcac 10857951  T
202 catgttgccctttt 215  Q
    |  |||||||||||    
10857952 cgggttgccctttt 10857965  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #37
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 89 - 198
Target Start/End: Complemental strand, 17251002 - 17250891
Alignment:
89 tgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacacta--aatgatgggactccttcccggaccctgcgtatgcg 186  Q
    ||||||||||||| || ||||||||||||||||||| ||| |||||  || |||||||||| |  |||| |||||| | |||||| ||||||||||||      
17251002 tgttcaagtcctggaagcagcctcttgtgtaaaaaacaggttaaggcagcgtacaatacaccaataatggtgggaccctttcccgaaccctgcgtatgaa 17250903  T
187 ggagctttagtg 198  Q
    ||||||||||||    
17250902 ggagctttagtg 17250891  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #38
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 310 - 369
Target Start/End: Complemental strand, 24827400 - 24827341
Alignment:
310 ataacttaaaagaccaatatgttacaaacatcaaacttaaaggacctctgatgtaatttt 369  Q
    |||||||||| ||||||| |||||||||| ||||||||||||||||| ||||||||||||    
24827400 ataacttaaatgaccaatctgttacaaacctcaaacttaaaggacctatgatgtaatttt 24827341  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #39
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 140 - 215
Target Start/End: Original strand, 26102578 - 26102653
Alignment:
140 tacaatacactaaatgatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgccctttt 215  Q
    |||||||||| ||||| |||||| |||||||||||||||| |||||||||||| ||||| |||  |||||||||||    
26102578 tacaatacaccaaatggtgggaccccttcccggaccctgcttatgcgggagctctagtgcaccgggttgccctttt 26102653  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #40
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 105 - 198
Target Start/End: Original strand, 16225045 - 16225140
Alignment:
105 acagcctcttgtgtaaaaaatagggtaaggttgcctacaatacactaa--atgatgggactccttcccggaccctgcgtatgcgggagctttagtg 198  Q
    |||||||||| ||||||||| ||||||||  ||| |||||||||| ||  ||| |||||  ||||||||||||| || ||||||||||||||||||    
16225045 acagcctcttatgtaaaaaacagggtaagactgcgtacaatacaccaataatggtgggatcccttcccggaccccgcatatgcgggagctttagtg 16225140  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #41
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 58 - 130
Target Start/End: Complemental strand, 30962929 - 30962857
Alignment:
58 aaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggt 130  Q
    |||||||||||||||||| |  |||| |||   ||||||||||| ||||||||||||||||||||||||||||    
30962929 aaagttgttgtcatgtgattgaaaggtcacgacttcaagtcctggaaacagcctcttgtgtaaaaaatagggt 30962857  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #42
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 308 - 368
Target Start/End: Complemental strand, 41151450 - 41151390
Alignment:
308 aaataacttaaaagaccaatatgttacaaacatcaaacttaaaggacctctgatgtaattt 368  Q
    |||||||||||| |||||||||||||||||  ||||||||||||||||| || ||||||||    
41151450 aaataacttaaaggaccaatatgttacaaaactcaaacttaaaggacctatggtgtaattt 41151390  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #43
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 94 - 173
Target Start/End: Complemental strand, 23000338 - 23000260
Alignment:
94 aagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacactaaatgatgggactccttcccgga 173  Q
    |||||||| ||||||||||||||||| |||| | ||||||||| | |||||||||| ||||| |||||| ||||||||||    
23000338 aagtcctggaaacagcctcttgtgta-aaaacacggtaaggttccatacaatacaccaaatggtgggaccccttcccgga 23000260  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #44
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 121 - 219
Target Start/End: Original strand, 19729382 - 19729480
Alignment:
121 aaaatagggtaaggttgcctacaatacactaaatgatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgcccttttattt 219  Q
    |||| ||||||||| ||  |||||||||| ||||| |||||| |||||||||||||||| ||| |||||||| ||||| ||    ||||||||||||||    
19729382 aaaacagggtaaggctgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatacgggagctctagtgcactggattgcccttttattt 19729480  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #45
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 33 - 195
Target Start/End: Original strand, 24245405 - 24245565
Alignment:
33 gaggggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaa 132  Q
    |||||||||||| ||  ||||||||||||||||||||||||||||  |||| |||  |||||||||||| |||| | ||||| |||    || |||||||    
24245405 gaggggtaaccttggggcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaac-gtctcttatgt----aacagggtaa 24245499  T
133 ggttgcctacaatacac---taaatgatgggactccttcccggaccctgcgtatgcgggagcttta 195  Q
    |  | | |||||| |||    ||||  |||||| |||||| |||||||||||||||||||||||||    
24245500 gactacgtacaatgcaccaaaaaattgtgggaccccttcctggaccctgcgtatgcgggagcttta 24245565  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #46
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 165 - 215
Target Start/End: Complemental strand, 27468141 - 27468091
Alignment:
165 cttcccggaccctgcgtatgcgggagctttagtgtaccatgttgccctttt 215  Q
    |||||||||||||||||||||||||||||||||| |||  |||||||||||    
27468141 cttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctttt 27468091  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #47
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 90 - 198
Target Start/End: Complemental strand, 44742643 - 44742534
Alignment:
90 gttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaataca-ctaaatgatgggactccttcccggaccctgcgtatgcggg 188  Q
    |||||||| ||| |||||  ||| ||||||||||| ||||||||| ||| ||||||||| | ||||| |||||| |||||  ||||||| || |||||||    
44742643 gttcaagttctggaaacaatctcctgtgtaaaaaacagggtaaggctgcgtacaatacaccaaaatggtgggaccccttcttggaccctacggatgcggg 44742544  T
189 agctttagtg 198  Q
    ||| ||||||    
44742543 agcattagtg 44742534  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #48
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 90 - 193
Target Start/End: Complemental strand, 14018093 - 14017989
Alignment:
90 gttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacactaaa-tgatgggactccttcccggaccctgcgtatgcggg 188  Q
    ||||||||| || |||||| ||||||||||||||| ||||| ||  ||| |||||||||||||| || ||||||  ||||| |||||||||  ||||||     
14018093 gttcaagtcttggaaacagtctcttgtgtaaaaaacagggtgagactgcgtacaatacactaaattggtgggaccacttcctggaccctgcagatgcggt 14017994  T
189 agctt 193  Q
    |||||    
14017993 agctt 14017989  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #49
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 58 - 177
Target Start/End: Original strand, 35105902 - 35106022
Alignment:
58 aaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacacta-aatga 156  Q
    ||||||||||||| ||| ||  |||| |||  |||||||||||| ||||| |||||||||||||| | || |||||| ||| |||||||||| | ||||     
35105902 aaagttgttgtcacgtggctgaaaggtcacgggttcaagtcctggaaacaacctcttgtgtaaaagagagtgtaaggctgcgtacaatacaccagaatgg 35106001  T
157 tgggactccttcccggaccct 177  Q
    ||||||  ||||| |||||||    
35106002 tgggacctcttcctggaccct 35106022  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #50
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 157 - 198
Target Start/End: Original strand, 27507988 - 27508029
Alignment:
157 tgggactccttcccggaccctgcgtatgcgggagctttagtg 198  Q
    |||||| |||||||| ||||||||||||||||||||||||||    
27507988 tgggaccccttcccgaaccctgcgtatgcgggagctttagtg 27508029  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #51
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 150 - 215
Target Start/End: Complemental strand, 35107375 - 35107310
Alignment:
150 taaatgatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgccctttt 215  Q
    |||||| |||||| ||||||||||| ||| |||||||| |||||||||| |||  |||||||||||    
35107375 taaatggtgggaccccttcccggacgctgtgtatgcggaagctttagtgcaccgggttgccctttt 35107310  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #52
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 308 - 368
Target Start/End: Complemental strand, 6220228 - 6220168
Alignment:
308 aaataacttaaaagaccaatatgttacaaacatcaaacttaaaggacctctgatgtaattt 368  Q
    |||||||||||| ||||||| |||| ||||| ||||||||||||||||  | |||||||||    
6220228 aaataacttaaaggaccaatttgtttcaaacctcaaacttaaaggacccttaatgtaattt 6220168  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #53
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 311 - 355
Target Start/End: Complemental strand, 9399858 - 9399814
Alignment:
311 taacttaaaagaccaatatgttacaaacatcaaacttaaaggacc 355  Q
    |||||||||  ||||||||||||||||| ||||||||||||||||    
9399858 taacttaaagaaccaatatgttacaaacctcaaacttaaaggacc 9399814  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #54
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 308 - 368
Target Start/End: Original strand, 9400119 - 9400179
Alignment:
308 aaataacttaaaagaccaatatgttacaaacatcaaacttaaaggacctctgatgtaattt 368  Q
    |||||||||||| || ||||||||||||||| ||||||||||| || ||| ||||| ||||    
9400119 aaataacttaaacgatcaatatgttacaaacctcaaacttaaaagatctccgatgtgattt 9400179  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #55
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 32 - 76
Target Start/End: Complemental strand, 23286475 - 23286431
Alignment:
32 tgaggggtaacctcggcacaactggtaaagttgttgtcatgtgac 76  Q
    ||||||||||||| | | |||||||||||||||||||||||||||    
23286475 tgaggggtaaccttgtcgcaactggtaaagttgttgtcatgtgac 23286431  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #56
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 308 - 356
Target Start/End: Complemental strand, 27052453 - 27052405
Alignment:
308 aaataacttaaaagaccaatatgttacaaacatcaaacttaaaggacct 356  Q
    |||||||||||  ||||||| | ||||||||||||||||||||||||||    
27052453 aaataacttaagggaccaatctattacaaacatcaaacttaaaggacct 27052405  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #57
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 50 - 133
Target Start/End: Original strand, 11748270 - 11748353
Alignment:
50 caactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaag 133  Q
    |||||||| || ||||||||||||||||  || | |||  ||||||||| || |||||||||||| ||||||||  ||||||||    
11748270 caactggtgaaattgttgtcatgtgactgaaatgtcacgggttcaagtcttggaaacagcctcttttgtaaaaagcagggtaag 11748353  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #58
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 135 - 215
Target Start/End: Original strand, 16013510 - 16013592
Alignment:
135 ttgcctacaatacactaaa--tgatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgccctttt 215  Q
    |||| ||||||||||||||  || || ||| ||||||| |||||||| |||||||||||||||||| |||  |||| ||||||    
16013510 ttgcgtacaatacactaaaaatggtgcgaccccttcccagaccctgcctatgcgggagctttagtgcaccgggttgtcctttt 16013592  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #59
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 151 - 198
Target Start/End: Original strand, 18595910 - 18595957
Alignment:
151 aaatgatgggactccttcccggaccctgcgtatgcgggagctttagtg 198  Q
    ||||||| |||| ||||||||||||||| ||||||||||| |||||||    
18595910 aaatgataggaccccttcccggaccctgtgtatgcgggagttttagtg 18595957  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #60
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 308 - 355
Target Start/End: Original strand, 24909696 - 24909743
Alignment:
308 aaataacttaaaagaccaatatgttacaaacatcaaacttaaaggacc 355  Q
    |||||||||||| ||||||| |||||||||  ||||||||||||||||    
24909696 aaataacttaaaggaccaatttgttacaaatctcaaacttaaaggacc 24909743  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #61
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 116 - 159
Target Start/End: Original strand, 28873235 - 28873278
Alignment:
116 tgtaaaaaatagggtaaggttgcctacaatacactaaatgatgg 159  Q
    |||||| |||||||||||||||| |||||||||| |||||||||    
28873235 tgtaaagaatagggtaaggttgcgtacaatacaccaaatgatgg 28873278  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #62
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 80 - 195
Target Start/End: Original strand, 36918125 - 36918240
Alignment:
80 aaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacactaaatgatgggactccttcccggaccctgc 179  Q
    |||| ||||||||||||| ||| |||||   |||| ||||||||| ||||||||| ||  |||||||||| ||||  | ||| ||||||||  |||||      
36918125 aaggtcacatgttcaagttctggaaacaatttcttatgtaaaaaacagggtaaggctgtgtacaatacaccaaatagtaggattccttcccaaaccctat 36918224  T
180 gtatgcgggagcttta 195  Q
    ||||||| ||||||||    
36918225 gtatgcgagagcttta 36918240  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #63
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 312 - 367
Target Start/End: Complemental strand, 42667487 - 42667432
Alignment:
312 aacttaaaagaccaatatgttacaaacatcaaacttaaaggacctctgatgtaatt 367  Q
    |||||||| |||| || |||||||||| ||||||||||||||| | ||||||||||    
42667487 aacttaaaggacctatctgttacaaacgtcaaacttaaaggacatgtgatgtaatt 42667432  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #64
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 308 - 354
Target Start/End: Original strand, 6220475 - 6220521
Alignment:
308 aaataacttaaaagaccaatatgttacaaacatcaaacttaaaggac 354  Q
    ||||||||||||  |||||| |||||||||| |||||||||||||||    
6220475 aaataacttaaagaaccaatttgttacaaacctcaaacttaaaggac 6220521  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #65
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 308 - 354
Target Start/End: Complemental strand, 24827462 - 24827416
Alignment:
308 aaataacttaaaagaccaatatgttacaaacatcaaacttaaaggac 354  Q
    |||||||||||| ||| ||| | ||||||||||||||||||||||||    
24827462 aaataacttaaatgacaaatctattacaaacatcaaacttaaaggac 24827416  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #66
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 308 - 354
Target Start/End: Original strand, 27052626 - 27052672
Alignment:
308 aaataacttaaaagaccaatatgttacaaacatcaaacttaaaggac 354  Q
    |||||||||||| ||||||| ||||| |||| |||||||||||||||    
27052626 aaataacttaaaggaccaatctgttataaacctcaaacttaaaggac 27052672  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #67
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 308 - 357
Target Start/End: Complemental strand, 27127922 - 27127874
Alignment:
308 aaataacttaaaagaccaatatgttacaaacatcaaacttaaaggacctc 357  Q
    ||||||||||||  |||||| |||||||||| ||||||||||||||||||    
27127922 aaataacttaaataaccaatctgttacaaac-tcaaacttaaaggacctc 27127874  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #68
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 308 - 361
Target Start/End: Original strand, 27128168 - 27128220
Alignment:
308 aaataacttaaaagaccaatatgttacaaacatcaaacttaaaggacctctgat 361  Q
    ||||||| ||||| |||||| | |||||||| ||||||||||||||||||||||    
27128168 aaataacctaaaa-accaatctattacaaacctcaaacttaaaggacctctgat 27128220  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #69
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 123 - 198
Target Start/End: Original strand, 26457773 - 26457846
Alignment:
123 aatagggtaaggttgcctacaatacactaaatgatgggactccttcccggaccctgcgtatgcgggagctttagtg 198  Q
    |||||||||||| ||| |||||||||| || || |||||| |||  || |||| |||||||| |||||||||||||    
26457773 aatagggtaaggctgcgtacaatacaccaattggtgggacccct--cctgaccttgcgtatgagggagctttagtg 26457846  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #70
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 170 - 214
Target Start/End: Complemental strand, 30962815 - 30962771
Alignment:
170 cggaccctgcgtatgcgggagctttagtgtaccatgttgcccttt 214  Q
    ||||||||||||||||||||| ||||||| |||  ||||||||||    
30962815 cggaccctgcgtatgcgggagatttagtgaaccgggttgcccttt 30962771  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #71
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 35 - 107
Target Start/End: Original strand, 31454144 - 31454216
Alignment:
35 ggggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaaca 107  Q
    ||||||| || ||| |||| |||| |||||||||||||||  |  |||| |||||||||| ||||||||||||    
31454144 ggggtaatcttggcgcaaccggtatagttgttgtcatgtggttgaaaggtcacatgttcatgtcctgaaaaca 31454216  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 115; Significance: 3e-58; HSPs: 76)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 115; E-Value: 3e-58
Query Start/End: Original strand, 33 - 215
Target Start/End: Original strand, 24448844 - 24449026
Alignment:
33 gaggggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaa 132  Q
    |||||||||||| ||| |||||||||||||||||||||||||||| ||||| |||  |||||||||||| ||||||||| ||||||||||||||||||||    
24448844 gaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaacagccttttgtgtaaaaaatagggtaa 24448943  T
133 ggttgcctacaatacactaaatgatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgccctttt 215  Q
    || ||| |||||||||| ||||| |||||| |||||||||||||||||||||| |||||||||||| |||  |||||||||||    
24448944 ggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgcaggagctttagtgcaccgggttgccctttt 24449026  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 104; E-Value: 1e-51
Query Start/End: Original strand, 32 - 216
Target Start/End: Original strand, 38879534 - 38879720
Alignment:
32 tgaggggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggta 131  Q
    ||||||||||||| ||| ||||||||||||||||||||||||||||  |||| |||  |||||||||||| |||||||||||||| ||||||| ||||||    
38879534 tgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtataaaaaacagggta 38879633  T
132 aggttgcctacaatacacta--aatgatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgccctttta 216  Q
    ||| ||| |||||||||| |  |||| |||||| ||||||||||||||||||||||||||||||||||| |||  ||||||||||||    
38879634 aggctgcgtacaatacaccaataatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctttta 38879720  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 101; E-Value: 6e-50
Query Start/End: Original strand, 32 - 216
Target Start/End: Original strand, 41014272 - 41014455
Alignment:
32 tgaggggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggta 131  Q
    ||||||||||||| ||| |||||||||||||||||||||||||||| ||||| |||  |||||||||||| |||||||||||||||| ||||| ||||||    
41014272 tgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaacagcctcttgtgt-aaaaacagggta 41014370  T
132 aggttgcctacaatacactaaatgatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgccctttta 216  Q
    ||| ||| |||||||||| ||||| |||||| |||||| |||||| || |||||||||||||||||| |||  ||||||||||||    
41014371 aggctgcgtacaatacaccaaatggtgggaccccttcctggaccccgcatatgcgggagctttagtgcaccgggttgccctttta 41014455  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 94; E-Value: 9e-46
Query Start/End: Original strand, 36 - 218
Target Start/End: Complemental strand, 4619284 - 4619100
Alignment:
36 gggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggt 135  Q
    ||||||||| ||| |||||||||||||||||||||||||||| ||||| |||  |||||||||||| ||| |||||||||||||||||| |||||||||     
4619284 gggtaaccttggcgcaactggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaatagcctcttgtgtaaaaaacagggtaaggc 4619185  T
136 tgcctacaatacacta--aatgatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgcccttttatt 218  Q
    ||| |||||||||| |  |||| |||||| ||||||||||||| || |||||| ||||||||||| |||  ||||||||||||||    
4619184 tgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcgagagctttagtgcaccgggttgcccttttatt 4619100  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 84; E-Value: 9e-40
Query Start/End: Original strand, 33 - 215
Target Start/End: Original strand, 35710267 - 35710447
Alignment:
33 gaggggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaa 132  Q
    |||||||||||| ||| |||||||||||||||||||||||| |||  |||| |||  |||||||||||| ||||||||||||||||  ||||||||||||    
35710267 gaggggtaaccttggcgcaactggtaaagttgttgtcatgtaactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgt--aaaatagggtaa 35710364  T
133 ggttgcctacaatacactaaatgatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgccctttt 215  Q
    || ||| | |||||||| ||||| |||||| |||||||||| | ||| |||||||||||| ||||| |||  |||||||||||    
35710365 ggctgcgttcaatacaccaaatggtgggaccccttcccggaacatgcatatgcgggagctctagtgcaccgggttgccctttt 35710447  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 84; E-Value: 9e-40
Query Start/End: Original strand, 36 - 215
Target Start/End: Original strand, 43334159 - 43334340
Alignment:
36 gggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgt-aaaaaatagggtaagg 134  Q
    ||||||||| ||| ||||||||||||||||||||||||||||  |||| |||  |||||||||||| |||||||||| ||||| |||||| |||||||||    
43334159 gggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcctgtgtaaaaaaacagggtaagg 43334258  T
135 ttgcctacaatacac--taaatgatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgccctttt 215  Q
     ||| ||||||||||   ||||| |||||| ||||||||||||||||| ||||||||||||||||| |||  |||||||||||    
43334259 ctgcgtacaatacaccaaaaatggtgggaccccttcccggaccctgcg-atgcgggagctttagtgcaccgggttgccctttt 43334340  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 36 - 195
Target Start/End: Original strand, 27328709 - 27328870
Alignment:
36 gggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggt 135  Q
    ||||||||| | | ||| ||||||||||||||||||||||||  |||| |||| |||||||||||| |||||| ||||||||||||||| |||||||||     
27328709 gggtaaccttgacgcaattggtaaagttgttgtcatgtgactgaaaggtcacaggttcaagtcctggaaacagtctcttgtgtaaaaaacagggtaaggc 27328808  T
136 tgcctacaatacacta--aatgatgggactccttcccggaccctgcgtatgcgggagcttta 195  Q
    ||| |||||||||| |  |||| |||||| |||||||| |||||||||||||||||||||||    
27328809 tgcgtacaatacaccaataatggtgggaccccttcccgaaccctgcgtatgcgggagcttta 27328870  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 33 - 215
Target Start/End: Complemental strand, 8170163 - 8169983
Alignment:
33 gaggggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaa 132  Q
    ||||| |||||| ||| |||||||||||||||||||||||||||   |||| |||  |||||||||||| ||||||||| |||||||||| |  ||||||    
8170163 gagggctaaccttggcgcaactggtaaagttgttgtcatgtgaccgaaaggtcacgggttcaagtcctggaaacagccttttgtgtaaaaca--gggtaa 8170066  T
133 ggttgcctacaatacactaaatgatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgccctttt 215  Q
    || ||| |||||||||| ||||| |||||| |||||||||||||||| |||||||||| || |||| |||  |||||||||||    
8170065 ggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagtttcagtgcaccgggttgccctttt 8169983  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #9
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 54 - 198
Target Start/End: Complemental strand, 19143102 - 19142959
Alignment:
54 tggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacactaaa 153  Q
    ||||||| ||||||||| ||||||| || |||||| |||||||||||| ||||| |||||||||||||||  ||||||||| ||| |||| ||||| |||    
19143102 tggtaaaattgttgtcacgtgactaaaatgccacaggttcaagtcctggaaacaacctcttgtgtaaaaac-agggtaaggctgcgtacagtacaccaaa 19143004  T
154 tgatgggactccttcccggaccctgcgtatgcgggagctttagtg 198  Q
    || |||||| |||||||||||| |||||||||||||| |||||||    
19143003 tggtgggaccccttcccggaccatgcgtatgcgggagatttagtg 19142959  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #10
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 66 - 216
Target Start/End: Original strand, 32703411 - 32703559
Alignment:
66 tgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacactaaatgatgggactcc 165  Q
    ||||||||||||  |||| |||  |||||||||||| |||||||||||||||||||| |  |||||||| ||| |||||||||| ||||| |||||| ||    
32703411 tgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaca--gggtaaggctgcgtacaatacaccaaatggtgggacccc 32703508  T
166 ttcccggaccctgcgtatgcgggagctttagtgtaccatgttgccctttta 216  Q
    |||||||||||||| |||||||||||| ||||| |||  ||||||||||||    
32703509 ttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctttta 32703559  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #11
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 101 - 214
Target Start/End: Complemental strand, 7097872 - 7097760
Alignment:
101 gaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacactaaatgatgggactccttcccggaccctgcgtatgcgggagctttagtgta 200  Q
    |||||||||||||||||||||||  ||||||||||||| |||||||||| ||||| || ||| |||||||| |||||||||||||||||||||||||| |    
7097872 gaaaacagcctcttgtgtaaaaac-agggtaaggttgcgtacaatacaccaaatggtgagaccccttcccgaaccctgcgtatgcgggagctttagtgca 7097774  T
201 ccatgttgcccttt 214  Q
    ||||| ||||||||    
7097773 ccatgctgcccttt 7097760  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #12
Raw Score: 64; E-Value: 8e-28
Query Start/End: Original strand, 62 - 197
Target Start/End: Original strand, 1405170 - 1405305
Alignment:
62 ttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacactaaatgatggga 161  Q
    |||||||||||||||||||||| |||  |||||||||||| ||||| |||||| | |||||||||| ||||| |||| |||||||||| ||||| |||||    
1405170 ttgttgtcatgtgactagaaggtcacgggttcaagtcctggaaacaacctcttatataaaaaatagagtaagtttgcgtacaatacaccaaatggtggga 1405269  T
162 ctccttcccggaccctgcgtatgcgggagctttagt 197  Q
    | | |||| | ||||||| |||||||||||| ||||    
1405270 ccctttcctgaaccctgcatatgcgggagctctagt 1405305  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #13
Raw Score: 64; E-Value: 8e-28
Query Start/End: Original strand, 31 - 194
Target Start/End: Original strand, 22600406 - 22600569
Alignment:
31 ttgaggggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggt 130  Q
    |||||||||||||| | |  |||||||||||||||| |||||||||| |||||  ||  |||||||||||| |||||   | |||||||||| | |||||    
22600406 ttgaggggtaaccttgacgtaactggtaaagttgttatcatgtgactggaaggttacgggttcaagtcctggaaacaatattttgtgtaaaacacagggt 22600505  T
131 aaggttgcctacaatacactaaatgatgggactccttcccggaccctgcgtatgcgggagcttt 194  Q
    |||| ||  |||||||||| ||||| |||||  |||||||||| ||||||||||||||||||||    
22600506 aaggctgtgtacaatacaccaaatggtgggatcccttcccggatcctgcgtatgcgggagcttt 22600569  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #14
Raw Score: 64; E-Value: 8e-28
Query Start/End: Original strand, 89 - 196
Target Start/End: Original strand, 43574616 - 43574723
Alignment:
89 tgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacactaaatgatgggactccttcccggaccctgcgtatgcggg 188  Q
    ||||||||||||| |||||  |||||||||| |||| ||||||||| ||| ||||||| || ||||| |||||| |||||||||||||||||||||||||    
43574616 tgttcaagtcctggaaacaatctcttgtgtagaaaacagggtaaggctgcgtacaatataccaaatggtgggaccccttcccggaccctgcgtatgcggg 43574715  T
189 agctttag 196  Q
    ||||||||    
43574716 agctttag 43574723  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #15
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 55 - 198
Target Start/End: Complemental strand, 209086 - 208943
Alignment:
55 ggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaataca-ctaaa 153  Q
    |||||||||||||||||||||||| |||| |||| ||||||||||||  |||| ||||||||||| |||| ||||||||| ||| | ||||||| | |||    
209086 ggtaaagttgttgtcatgtgactaaaaggtcacaagttcaagtcctggcaacaacctcttgtgta-aaaacagggtaaggctgcattcaatacaccaaaa 208988  T
154 tgatgggactccttcccggaccctgcgtatgcgggagctttagtg 198  Q
    || |||||| |||||| |||||||| ||||||  |||||||||||    
208987 tggtgggaccccttcctggaccctgggtatgcaagagctttagtg 208943  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #16
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 30 - 134
Target Start/End: Original strand, 23974732 - 23974835
Alignment:
30 tttgaggggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaataggg 129  Q
    ||||||||||||||| ||| |||| ||||||||||||||||||||||| ||||| |||  |||||||||||| ||||| |||||||||||||||| ||||    
23974732 tttgaggggtaaccttggcgcaac-ggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaacaacctcttgtgtaaaaaagaggg 23974830  T
130 taagg 134  Q
    |||||    
23974831 taagg 23974835  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #17
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 50 - 213
Target Start/End: Complemental strand, 12006494 - 12006329
Alignment:
50 caactggtaaagttgttgtcatgtgactagaaggccacatg-ttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaataca 148  Q
    |||||| | |||||||||||||||||||  |||| |||  | |||||||| || ||||| |||||| ||||||||||||||||||| | | |||||||||    
12006494 caactgctcaagttgttgtcatgtgactgaaaggtcacggggttcaagtc-tggaaacaacctcttatgtaaaaaatagggtaaggctccatacaataca 12006396  T
149 ctaa--atgatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgccctt 213  Q
    | ||  ||| |||||| ||||||| |||||||| |||||||||||||||||| ||| ||||||||||    
12006395 ccaataatggtgggaccccttcccagaccctgcctatgcgggagctttagtgcaccgtgttgccctt 12006329  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #18
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 90 - 214
Target Start/End: Complemental strand, 13801893 - 13801767
Alignment:
90 gttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacacta--aatgatgggactccttcccggaccctgcgtatgcgg 187  Q
    |||||||||||| || ||||||||||||||||||| ||||||||| ||| |||||||||| |  |||| |||||| ||||||||||||| || ||||||     
13801893 gttcaagtcctggaagcagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcga 13801794  T
188 gagctttagtgtaccatgttgcccttt 214  Q
    ||||||||||| |||  ||||||||||    
13801793 gagctttagtgcaccgggttgcccttt 13801767  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #19
Raw Score: 59; E-Value: 7e-25
Query Start/End: Original strand, 33 - 214
Target Start/End: Original strand, 1565385 - 1565566
Alignment:
33 gaggggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaat-agggta 131  Q
    |||||||||||| ||| ||||||||||||||||||||||||||||  |||| | |  |||||||||||| ||||| ||||||| ||||||||  |   ||    
1565385 gaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcgcgggttcaagtcctggaaacaacctcttgagtaaaaaaacatatta 1565484  T
132 aggttgcctacaatacactaaatgatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgcccttt 214  Q
    ||| ||| |||||| ||| |||||  ||||| |||||||||||||||| |||| |||||| |||||| |||  ||||||||||    
1565485 aggctgcgtacaatgcaccaaatggcgggaccccttcccggaccctgcatatgtgggagc-ttagtgcaccgggttgcccttt 1565566  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #20
Raw Score: 59; E-Value: 7e-25
Query Start/End: Original strand, 104 - 198
Target Start/End: Complemental strand, 16880757 - 16880663
Alignment:
104 aacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacactaaatgatgggactccttcccggaccctgcgtatgcgggagctttagtg 198  Q
    ||||||||||||||||||||| ||||||||| ||| |||||||||| ||||| || |||  ||||||||||| ||||||||||||||||||||||    
16880757 aacagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaaatggtgtgaccacttcccggaccatgcgtatgcgggagctttagtg 16880663  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #21
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 55 - 215
Target Start/End: Complemental strand, 28516593 - 28516432
Alignment:
55 ggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaataca-ctaaa 153  Q
    |||||||||||||||| ||| ||  |||| |||  ||||||||| || ||||| |||||||||||||||| ||| || || ||| ||||||||| | |||    
28516593 ggtaaagttgttgtcaggtggctgaaaggtcacgggttcaagtcttggaaacatcctcttgtgtaaaaaacaggctagggctgcgtacaatacatcaaaa 28516494  T
154 tgatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgccctttt 215  Q
    || |||||| | ||||| ||||||||| |||| |||||||||||| |||| |||||||||||    
28516493 tggtgggacccattcccagaccctgcgcatgcaggagctttagtggaccaggttgccctttt 28516432  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #22
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 30 - 122
Target Start/End: Complemental strand, 37024738 - 37024646
Alignment:
30 tttgaggggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaa 122  Q
    ||||||||||||||| ||  ||||||||||||||||||||||||||||  |||| |||  |||||||||||| ||||||||||||||||||||    
37024738 tttgaggggtaaccttggtgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaa 37024646  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #23
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 56 - 203
Target Start/End: Complemental strand, 31694266 - 31694119
Alignment:
56 gtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacactaaatg 155  Q
    ||||||||||||||| ||||||   ||| || | ||||||||| |||||| || | || |||||||||||||| ||| | ||| ||||||||||  | ||    
31694266 gtaaagttgttgtcacgtgactgataggtcataggttcaagtcttgaaaaaagtcactcgtgtaaaaaataggctaaagctgcatacaatacacctattg 31694167  T
156 atgggactccttcccggaccctgcgtatgcgggagctttagtgtacca 203  Q
    ||||||||||||||| |||| |||||||||||||| ||||||| ||||    
31694166 atgggactccttcccagaccttgcgtatgcgggagatttagtgcacca 31694119  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #24
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 34 - 191
Target Start/End: Original strand, 2838733 - 2838890
Alignment:
34 aggggtaacctcggcacaactggtaaagttgttgtcatgtgactagaa-ggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaa 132  Q
    ||||||||||| ||| |||| |||||||||||||||||||||||  || || |||  | |||||||    ||||||| |||||||||||||  |||||||    
2838733 aggggtaaccttggcgcaaccggtaaagttgttgtcatgtgactgtaaaggtcacgaggtcaagtctcagaaacagcatcttgtgtaaaaac-agggtaa 2838831  T
133 ggttgcctacaatacactaaatgatgggactccttcccggaccctgcgtatgcgggagc 191  Q
    || ||| |||||||||| ||||| |||||  ||||| ||||||||||||||||||||||    
2838832 ggctgcgtacaatacaccaaatggtgggatcccttctcggaccctgcgtatgcgggagc 2838890  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #25
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 50 - 219
Target Start/End: Original strand, 30006296 - 30006464
Alignment:
50 caactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacac 149  Q
    |||||| |||| ||||||||||||||||  |||| || |  ||||||||| ||||||| |||||| | |||| || ||||||||| ||  |||| |||||    
30006296 caactgataaatttgttgtcatgtgactgaaaggtcatagattcaagtccggaaaacaacctcttatataaacaacagggtaaggctgtgtacattacac 30006395  T
150 taaatgatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgcccttttattt 219  Q
    |||||| |||||| |||||||||  |||  ||||||||||||||||||| |||  |||| ||||||||||    
30006396 taaatggtgggaccccttcccggggcctatgtatgcgggagctttagtgcaccgggttg-ccttttattt 30006464  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #26
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 140 - 216
Target Start/End: Original strand, 16957375 - 16957451
Alignment:
140 tacaatacactaaatgatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgccctttta 216  Q
    |||||||||| ||||| |||||| ||||||||||||||||||||||||||||||||||| |||  ||||||||||||    
16957375 tacaatacaccaaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctttta 16957451  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #27
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 94 - 211
Target Start/End: Original strand, 7368413 - 7368528
Alignment:
94 aagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacactaaatgatgggactccttcccggaccctgcgtatgcgggagctt 193  Q
    |||||||| |||||||||||||||||||| |  |||||||| ||| |||||||||| || || |||||| |||||||||||||||| |||| |||||||     
7368413 aagtcctggaaacagcctcttgtgtaaaaca--gggtaaggctgcgtacaatacaccaattggtgggaccccttcccggaccctgcatatgtgggagctc 7368510  T
194 tagtgtaccatgttgccc 211  Q
    ||||| |||  |||||||    
7368511 tagtgcaccgggttgccc 7368528  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #28
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 31 - 214
Target Start/End: Original strand, 22187237 - 22187422
Alignment:
31 ttgaggggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggt 130  Q
    |||||||||||| | ||| ||||| |||||||||||||||| |||||  |||| |||  ||| |||||||| |||||||||||||||||||||| | | |    
22187237 ttgaggggtaactttggcgcaactagtaaagttgttgtcatttgactgaaaggtcaccggtttaagtcctggaaacagcctcttgtgtaaaaaacatgat 22187336  T
131 aaggttgcctacaatacac--taaatgatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgcccttt 214  Q
    |||  ||| ||||||||||   |||  ||| ||| |||||||  ||||| | ||||| |||||||||||| | || ||||||||||    
22187337 aagactgcgtacaatacaccaaaaacaatgagaccccttcccaaaccctacatatgcaggagctttagtgcatcaggttgcccttt 22187422  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #29
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 90 - 198
Target Start/End: Complemental strand, 42924958 - 42924846
Alignment:
90 gttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacac--taaatgatgggactccttcccgg--accctgcgtatgc 185  Q
    |||||||||||||||||| | |||||||||||||| ||||||||||||| ||||||||||   ||||||||| |  ||||||| |  |||||||||||||    
42924958 gttcaagtcctgaaaacaacatcttgtgtaaaaaacagggtaaggttgcgtacaatacaccaaaaatgatggaatcccttcccagacaccctgcgtatgc 42924859  T
186 gggagctttagtg 198  Q
    || ||||||||||    
42924858 ggaagctttagtg 42924846  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #30
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 94 - 198
Target Start/End: Complemental strand, 5873441 - 5873338
Alignment:
94 aagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacactaaatgatgggactccttcccggaccctgcgtatgcgggagctt 193  Q
    ||||| || ||||||||||||||||||||| |||||||||| |   |||| ||||| || || |||||||||| ||||||| ||||||||||||||||||    
5873441 aagtcgtggaaacagcctcttgtgtaaaaa-tagggtaaggctaagtacactacaccaattggtgggactcctccccggacactgcgtatgcgggagctt 5873343  T
194 tagtg 198  Q
    |||||    
5873342 tagtg 5873338  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #31
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 36 - 217
Target Start/End: Complemental strand, 22861844 - 22861666
Alignment:
36 gggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggt 135  Q
    ||||||||| |||||||||| |||||||||||||||||||||  |||| |||   ||||||||||  || ||| ||||||||||||| |    |||||      
22861844 gggtaaccttggcacaactgataaagttgttgtcatgtgactgaaaggtcacggattcaagtcctagaagcagtctcttgtgtaaaaca---agtaagac 22861748  T
136 tgcctacaatacactaaatgatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgcccttttat 217  Q
    |||  ||||||||  ||||| |||||| ||||| || ||||||| |||||||||||| ||||| |||   ||||||||||||    
22861747 tgctcacaatacatcaaatggtgggaccccttctcgaaccctgcatatgcgggagctctagtgcaccgaattgcccttttat 22861666  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #32
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 98 - 213
Target Start/End: Original strand, 20135623 - 20135740
Alignment:
98 cctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacacta--aatgatgggactccttcccggaccctgcgtatgcgggagcttta 195  Q
    |||| |||||||||||||||||||||| | ||||||| ||| |||||||||| |  |||| |||||| ||||||||||||| || ||||| ||||||| |    
20135623 cctggaaacagcctcttgtgtaaaaaacaaggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcaggagcttca 20135722  T
196 gtgtaccatgttgccctt 213  Q
    ||| |||  |||||||||    
20135723 gtgcaccgggttgccctt 20135740  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #33
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 103 - 216
Target Start/End: Original strand, 29334419 - 29334533
Alignment:
103 aaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacacta-aatgatgggactccttcccggaccctgcgtatgcgggagctttagtgtac 201  Q
    |||||||||||||||||||||| | ||||||| ||| |||||||||| | |||| |||||| | ||||||||||||||||||| |||| ||||| || ||    
29334419 aaacagcctcttgtgtaaaaaacaaggtaaggctgcgtacaatacaccagaatggtgggacccattcccggaccctgcgtatgtgggatctttaatgcac 29334518  T
202 catgttgccctttta 216  Q
    |  | ||||||||||    
29334519 cgggctgccctttta 29334533  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #34
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 57 - 194
Target Start/End: Complemental strand, 24323862 - 24323725
Alignment:
57 taaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacactaaatga 156  Q
    |||||||||| || |||||||  || | || |||||||||| ||| ||||| |||||||||||||| | |||||||| |||| || ||||| | ||||      
24323862 taaagttgttatcgtgtgactgaaatgtcaaatgttcaagttctggaaacaacctcttgtgtaaaagacagggtaagcttgcgtataatactccaaatag 24323763  T
157 tgggactccttcccggaccctgcgtatgcgggagcttt 194  Q
    |||||| ||||||| |||||||  ||||||||||||||    
24323762 tgggaccccttcccagaccctgtatatgcgggagcttt 24323725  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #35
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 57 - 194
Target Start/End: Complemental strand, 24360486 - 24360349
Alignment:
57 taaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacactaaatga 156  Q
    |||||||||| || |||||||  || | || |||||||||| ||| ||||| |||||||||||||| | |||||||| |||| || ||||| | ||||      
24360486 taaagttgttatcgtgtgactgaaatgtcaaatgttcaagttctggaaacaacctcttgtgtaaaagacagggtaagcttgcgtataatactccaaatag 24360387  T
157 tgggactccttcccggaccctgcgtatgcgggagcttt 194  Q
    |||||| ||||||| |||||||  ||||||||||||||    
24360386 tgggaccccttcccagaccctgtatatgcgggagcttt 24360349  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #36
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 93 - 194
Target Start/End: Complemental strand, 24903817 - 24903716
Alignment:
93 caagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacactaaatgatgggactccttcccggaccctgcgtatgcgggagct 192  Q
    ||||||||||||||||||| ||||||||||||||||||||| |||  |||||| ||| || || || ||| ||||||||||| |||| || |||||| ||    
24903817 caagtcctgaaaacagccttttgtgtaaaaaatagggtaagattgtgtacaatccaccaattggtgagaccccttcccggacactgcatacgcgggaact 24903718  T
193 tt 194  Q
    ||    
24903717 tt 24903716  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #37
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 59 - 192
Target Start/End: Complemental strand, 34074717 - 34074584
Alignment:
59 aagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacactaaatgatg 158  Q
    ||||||||||||  |||||  |||| |||| |||||||||||  |||||||||||||||||||||| |  |||||||||| | |||||||| |||||       
34074717 aagttgttgtcacatgactgaaaggtcacaagttcaagtcctagaaacagcctcttgtgtaaaaaacacagtaaggttgcgttcaatacaccaaatggca 34074618  T
159 ggactccttcccggaccctgcgtatgcgggagct 192  Q
    || | |||||||  |||||||||||| |||||||    
34074617 gggccccttcccaaaccctgcgtatgggggagct 34074584  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #38
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 126 - 214
Target Start/End: Complemental strand, 34154902 - 34154814
Alignment:
126 agggtaaggttgcctacaatacactaaatgatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgcccttt 214  Q
    ||||||||| ||| |||||||||| ||||| |||||| |||||||||||||||| ||||||| |||| ||||| |||  ||||||||||    
34154902 agggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcggtagctctagtgcaccgggttgcccttt 34154814  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #39
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 308 - 372
Target Start/End: Complemental strand, 28559280 - 28559216
Alignment:
308 aaataacttaaaagaccaatatgttacaaacatcaaacttaaaggacctctgatgtaattttccc 372  Q
    |||||||||||| ||||||| |||||||||| ||||||||||||||||  |||| ||||||||||    
28559280 aaataacttaaaggaccaatctgttacaaacgtcaaacttaaaggacccgtgatataattttccc 28559216  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #40
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 55 - 190
Target Start/End: Original strand, 39301099 - 39301235
Alignment:
55 ggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaataca-ctaaa 153  Q
    ||||||||||||||||||| |||  |||| |||  ||||||||| ||  |||| ||||||||||| |||| ||||||||| ||| || ||| || | |||    
39301099 ggtaaagttgttgtcatgttactgaaaggtcacgggttcaagtcttgggaacaacctcttgtgtataaaacagggtaaggatgcgtataatgcaccaaaa 39301198  T
154 tgatgggactccttcccggaccctgcgtatgcgggag 190  Q
     | |||||| |||||||||||||| |||||| |||||    
39301199 aggtgggaccccttcccggaccctccgtatgtgggag 39301235  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #41
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 63 - 198
Target Start/End: Original strand, 1850624 - 1850758
Alignment:
63 tgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacactaaatgatgggac 162  Q
    |||||||||||||||  |||| |||  |||||||||| | ||| | |||||||||| ||||| ||  ||||| ||| |||||||||  ||||| ||||||    
1850624 tgttgtcatgtgactgaaaggtcacgggttcaagtcccggaaataacctcttgtgt-aaaaacagaataagggtgcgtacaatacatcaaatggtgggac 1850722  T
163 tccttcccggaccctgcgtatgcgggagctttagtg 198  Q
      ||||| |||||||||| |||||| ||||||||||    
1850723 cacttcctggaccctgcggatgcggaagctttagtg 1850758  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #42
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 97 - 194
Target Start/End: Complemental strand, 12575779 - 12575680
Alignment:
97 tcctgaaaacagcctcttgtgtaaa-aaatagggtaaggttgcctacaatacactaaa-tgatgggactccttcccggaccctgcgtatgcgggagcttt 194  Q
    ||||| ||||||||||||| ||||| ||| ||| ||| ||||| |||||||||| ||| || |||||| |||||| ||||||||||||||| ||||||||    
12575779 tcctggaaacagcctcttgcgtaaataaacaggctaaagttgcgtacaatacaccaaaatggtgggaccccttcctggaccctgcgtatgcaggagcttt 12575680  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #43
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 152 - 198
Target Start/End: Original strand, 25622533 - 25622579
Alignment:
152 aatgatgggactccttcccggaccctgcgtatgcgggagctttagtg 198  Q
    |||| |||||| |||||||||||||||||||||||||||||||||||    
25622533 aatggtgggaccccttcccggaccctgcgtatgcgggagctttagtg 25622579  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #44
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 151 - 195
Target Start/End: Complemental strand, 10306537 - 10306493
Alignment:
151 aaatgatgggactccttcccggaccctgcgtatgcgggagcttta 195  Q
    ||||| |||||| ||||||||||||||||||||||||||||||||    
10306537 aaatggtgggaccccttcccggaccctgcgtatgcgggagcttta 10306493  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #45
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 312 - 368
Target Start/End: Original strand, 10827402 - 10827458
Alignment:
312 aacttaaaagaccaatatgttacaaacatcaaacttaaaggacctctgatgtaattt 368  Q
    |||||||| ||||||| | |||||||| ||||||||||| |||||||||||||||||    
10827402 aacttaaaggaccaatttattacaaacctcaaacttaaatgacctctgatgtaattt 10827458  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #46
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 308 - 368
Target Start/End: Original strand, 17400839 - 17400899
Alignment:
308 aaataacttaaaagaccaatatgttacaaacatcaaacttaaaggacctctgatgtaattt 368  Q
    |||||||||||| |||||||||||||||||  ||||||||||||||| | || ||||||||    
17400839 aaataacttaaatgaccaatatgttacaaatctcaaacttaaaggacttatggtgtaattt 17400899  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #47
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 90 - 134
Target Start/End: Original strand, 22025554 - 22025598
Alignment:
90 gttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaagg 134  Q
    |||||||||||| |||||||||||||||||||||| |||||||||    
22025554 gttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaagg 22025598  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #48
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 164 - 216
Target Start/End: Original strand, 32354212 - 32354264
Alignment:
164 ccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgccctttta 216  Q
    ||||||||||||||| ||||||||||||||||||| |||  ||||||||||||    
32354212 ccttcccggaccctgtgtatgcgggagctttagtgcaccgggttgccctttta 32354264  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #49
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 308 - 368
Target Start/End: Complemental strand, 35461481 - 35461421
Alignment:
308 aaataacttaaaagaccaatatgttacaaacatcaaacttaaaggacctctgatgtaattt 368  Q
    |||||||||||| ||||||||| |||||||| ||||||||||||||||  || ||||||||    
35461481 aaataacttaaaggaccaatatattacaaacctcaaacttaaaggacccgtggtgtaattt 35461421  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #50
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 90 - 186
Target Start/End: Original strand, 41425959 - 41426055
Alignment:
90 gttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacactaaatgatgggactccttcccggaccctgcgtatgcg 186  Q
    |||||||| ||| ||||| | | |||||||||||| ||||||||| ||| |||||||||| || || |||||| ||||||| ||| ||||| |||||    
41425959 gttcaagttctggaaacaacttattgtgtaaaaaacagggtaaggctgcatacaatacaccaattggtgggaccccttcccagactctgcggatgcg 41426055  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #51
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 157 - 215
Target Start/End: Complemental strand, 16028681 - 16028623
Alignment:
157 tgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgccctttt 215  Q
    |||||| |||||||||||||||| |||||||||||| ||||| |||  |||||||||||    
16028681 tgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctttt 16028623  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #52
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 308 - 354
Target Start/End: Complemental strand, 16327203 - 16327157
Alignment:
308 aaataacttaaaagaccaatatgttacaaacatcaaacttaaaggac 354  Q
    |||||||||||| ||||||| |||||||||| |||||||||||||||    
16327203 aaataacttaaacgaccaatctgttacaaacctcaaacttaaaggac 16327157  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #53
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 308 - 354
Target Start/End: Complemental strand, 25456380 - 25456334
Alignment:
308 aaataacttaaaagaccaatatgttacaaacatcaaacttaaaggac 354  Q
    |||||||||||| ||||||| |||||||||| |||||||||||||||    
25456380 aaataacttaaaggaccaatctgttacaaacctcaaacttaaaggac 25456334  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #54
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 50 - 116
Target Start/End: Original strand, 31299603 - 31299669
Alignment:
50 caactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgt 116  Q
    ||||||||||||||||||||||||||||   ||| |||  |||||||||||  ||||||||||||||    
31299603 caactggtaaagttgttgtcatgtgacttacaggtcactagttcaagtcctagaaacagcctcttgt 31299669  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #55
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 119 - 216
Target Start/End: Original strand, 3771379 - 3771476
Alignment:
119 aaaaaatagggtaaggttgcctacaatacactaaatgatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgccctttta 216  Q
    |||||| ||||||||| ||   ||||||||| || || |||||| ||||||||||| ||| ||||| ||||||||||||| |||  | ||||||||||    
3771379 aaaaaacagggtaaggctgtgaacaatacaccaattggtgggaccccttcccggactctgtgtatgtgggagctttagtgcaccgggctgccctttta 3771476  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #56
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 85 - 198
Target Start/End: Original strand, 18426045 - 18426158
Alignment:
85 cacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacactaaatgatgggactccttcccggaccctgcgtatg 184  Q
    |||| ||| ||||| ||||||||  |||||||||||||||||| | |||||||  |||||||||   |||| || ||| ||||  || || |||||||||    
18426045 cacaggtttaagtcttgaaaacaatctcttgtgtaaaaaatagagaaaggttgtgtacaatacatcgaatggtgagaccccttttcgaactctgcgtatg 18426144  T
185 cgggagctttagtg 198  Q
    || |||||||||||    
18426145 cgagagctttagtg 18426158  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #57
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 33 - 78
Target Start/End: Original strand, 19438703 - 19438748
Alignment:
33 gaggggtaacctcggcacaactggtaaagttgttgtcatgtgacta 78  Q
    |||||||||||| ||| |||||||||||||||||||||| ||||||    
19438703 gaggggtaaccttggcgcaactggtaaagttgttgtcatatgacta 19438748  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #58
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 308 - 368
Target Start/End: Complemental strand, 16327143 - 16327083
Alignment:
308 aaataacttaaaagaccaatatgttacaaacatcaaacttaaaggacctctgatgtaattt 368  Q
    |||||||||||| || |||| | |||||||| || ||||||||||||||||| ||||||||    
16327143 aaataacttaaacgatcaatctattacaaacctctaacttaaaggacctctggtgtaattt 16327083  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #59
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 310 - 354
Target Start/End: Original strand, 19550312 - 19550356
Alignment:
310 ataacttaaaagaccaatatgttacaaacatcaaacttaaaggac 354  Q
    ||||||||||||| |||| ||||||||||||||||||| ||||||    
19550312 ataacttaaaagatcaatctgttacaaacatcaaacttgaaggac 19550356  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #60
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 151 - 211
Target Start/End: Complemental strand, 21784395 - 21784335
Alignment:
151 aaatgatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgccc 211  Q
    ||||| |||||| |||| |||||||||||||||||||||| ||||||| |||  |||||||    
21784395 aaatggtgggacccctttccggaccctgcgtatgcgggaggtttagtgcaccgagttgccc 21784335  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #61
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 90 - 162
Target Start/End: Complemental strand, 22907988 - 22907917
Alignment:
90 gttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacactaaatgatgggac 162  Q
    ||||||||||   ||||||||||||||||| |||| || |||||||||| |||||||||| ||||| ||||||    
22907988 gttcaagtccaagaaacagcctcttgtgta-aaaacagagtaaggttgcatacaatacaccaaatggtgggac 22907917  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #62
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 308 - 368
Target Start/End: Original strand, 35461728 - 35461788
Alignment:
308 aaataacttaaaagaccaatatgttacaaacatcaaacttaaaggacctctgatgtaattt 368  Q
    |||||||||||| ||||||| | |||||||| |||||||||||||||  |||||| |||||    
35461728 aaataacttaaaggaccaatctattacaaacctcaaacttaaaggacacctgatgcaattt 35461788  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #63
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 308 - 355
Target Start/End: Original strand, 19550359 - 19550406
Alignment:
308 aaataacttaaaagaccaatatgttacaaacatcaaacttaaaggacc 355  Q
    |||||||||||| || |||| |||||||||| ||||||||||||||||    
19550359 aaataacttaaaggaacaatctgttacaaacctcaaacttaaaggacc 19550406  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #64
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 157 - 216
Target Start/End: Original strand, 39801594 - 39801653
Alignment:
157 tgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgccctttta 216  Q
    |||||| ||||||| |||||| |||||||||||||||||||| |||  |||||| |||||    
39801594 tgggaccccttcccagaccctacgtatgcgggagctttagtgcaccgggttgccatttta 39801653  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #65
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 308 - 354
Target Start/End: Original strand, 12713119 - 12713165
Alignment:
308 aaataacttaaaagaccaatatgttacaaacatcaaacttaaaggac 354  Q
    ||||||||||||||| |||||||||| |||  |||||||||||||||    
12713119 aaataacttaaaagatcaatatgttagaaatctcaaacttaaaggac 12713165  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #66
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 308 - 354
Target Start/End: Original strand, 12774383 - 12774429
Alignment:
308 aaataacttaaaagaccaatatgttacaaacatcaaacttaaaggac 354  Q
    ||||||||||||||| |||||||||| |||  |||||||||||||||    
12774383 aaataacttaaaagatcaatatgttagaaatctcaaacttaaaggac 12774429  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #67
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 164 - 198
Target Start/End: Original strand, 13774950 - 13774984
Alignment:
164 ccttcccggaccctgcgtatgcgggagctttagtg 198  Q
    |||| ||||||||||||||||||||||||||||||    
13774950 cctttccggaccctgcgtatgcgggagctttagtg 13774984  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #68
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 308 - 354
Target Start/End: Original strand, 16327331 - 16327377
Alignment:
308 aaataacttaaaagaccaatatgttacaaacatcaaacttaaaggac 354  Q
    |||||||||||| || |||| |||||||||| |||||||||||||||    
16327331 aaataacttaaaggatcaatctgttacaaacctcaaacttaaaggac 16327377  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #69
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 316 - 358
Target Start/End: Original strand, 28559536 - 28559578
Alignment:
316 taaaagaccaatatgttacaaacatcaaacttaaaggacctct 358  Q
    |||| ||| ||| ||||||||||||||||||||||||||||||    
28559536 taaaggactaatttgttacaaacatcaaacttaaaggacctct 28559578  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #70
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 315 - 376
Target Start/End: Original strand, 6588140 - 6588200
Alignment:
315 ttaaaagaccaatatgttacaaacatcaaacttaaaggacctctgatgtaattttcccaaaa 376  Q
    ||||| ||||||||| |||||||| |||||| | ||||||| ||| ||||||||||||||||    
6588140 ttaaaggaccaatatattacaaacctcaaacgttaaggacc-ctggtgtaattttcccaaaa 6588200  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #71
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 151 - 192
Target Start/End: Complemental strand, 21542530 - 21542489
Alignment:
151 aaatgatgggactccttcccggaccctgcgtatgcgggagct 192  Q
    ||||| |||||| ||||||||||| |||||||||||||||||    
21542530 aaatggtgggaccccttcccggactctgcgtatgcgggagct 21542489  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #72
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 157 - 214
Target Start/End: Complemental strand, 30877621 - 30877564
Alignment:
157 tgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgcccttt 214  Q
    |||||| |||||||||||||||| |||| ||||||| ||||| |||  ||||||||||    
30877621 tgggaccccttcccggaccctgcatatgtgggagctctagtgcaccgggttgcccttt 30877564  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #73
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 308 - 352
Target Start/End: Original strand, 23662171 - 23662215
Alignment:
308 aaataacttaaaagaccaatatgttacaaacatcaaacttaaagg 352  Q
    |||||||||||| ||||||| | |||||||| |||||||||||||    
23662171 aaataacttaaaggaccaatttattacaaacctcaaacttaaagg 23662215  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #74
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 308 - 352
Target Start/End: Complemental strand, 23796417 - 23796373
Alignment:
308 aaataacttaaaagaccaatatgttacaaacatcaaacttaaagg 352  Q
    |||||||||||| ||||||| | |||||||| |||||||||||||    
23796417 aaataacttaaaggaccaatttattacaaacctcaaacttaaagg 23796373  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #75
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 157 - 213
Target Start/End: Complemental strand, 29184118 - 29184062
Alignment:
157 tgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgccctt 213  Q
    |||||||||||  | |||| |||||||||||||||||||||| |||  |||||||||    
29184118 tgggactccttgtcagaccatgcgtatgcgggagctttagtgcaccgggttgccctt 29184062  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #76
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 308 - 368
Target Start/End: Complemental strand, 32361213 - 32361153
Alignment:
308 aaataacttaaaagaccaatatgttacaaacatcaaacttaaaggacctctgatgtaattt 368  Q
    |||||||||||| || |||| | |||||||| ||||| ||||||||| |||| ||||||||    
32361213 aaataacttaaatgatcaatctattacaaacttcaaatttaaaggacttctggtgtaattt 32361153  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 113; Significance: 4e-57; HSPs: 83)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 113; E-Value: 4e-57
Query Start/End: Original strand, 33 - 217
Target Start/End: Complemental strand, 8455497 - 8455313
Alignment:
33 gaggggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaa 132  Q
    |||||||||||| ||| |||||||||||||||||||||||||||| ||||| |||  |||||||||||| |||||||||||||||||||| | |||||||    
8455497 gaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaacacagggtaa 8455398  T
133 ggttgcctacaatacactaaatgatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgcccttttat 217  Q
    || ||| |||||||||| ||||| |||||| |||||||||||||||||||||| |||||||||||| |||  |||||||||||||    
8455397 ggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgccggagctttagtgcaccgggttgcccttttat 8455313  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 30 - 214
Target Start/End: Original strand, 14530269 - 14530455
Alignment:
30 tttgaggggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaataggg 129  Q
    ||||||||||||||| ||| ||||||||||||||||||||||||||||  |||| |||  |||||||||||| |||||||||||||| ||||||| ||||    
14530269 tttgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtataaaaaacaggg 14530368  T
130 taaggttgcctacaatacacta--aatgatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgcccttt 214  Q
    ||||| | | |||||||||| |  |||| |||||| ||||||||||||||||||||||||||||||||||| |||  ||||||||||    
14530369 taaggctacgtacaatacaccaataatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttt 14530455  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 96; E-Value: 6e-47
Query Start/End: Original strand, 34 - 214
Target Start/End: Original strand, 10543653 - 10543835
Alignment:
34 aggggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaag 133  Q
    ||||||||||| ||| |||||| |||||||||||||||||||||  |||| |||  |||||||||||| |||| ||||||||||||||||| ||||||||    
10543653 aggggtaaccttggcgcaactgataaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacggcctcttgtgtaaaaaacagggtaag 10543752  T
134 gttgcctacaatacac--taaatgatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgcccttt 214  Q
    | ||| ||||||||||   ||||| |||||| ||||||||||||||||||||||||||||||||||| |||  ||||||||||    
10543753 gctgcgtacaatacaccaaaaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttt 10543835  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 96; E-Value: 6e-47
Query Start/End: Original strand, 32 - 218
Target Start/End: Complemental strand, 21779441 - 21779257
Alignment:
32 tgaggggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggta 131  Q
    ||||||||||||| ||| |||||||| |||||||||||||||||||  |||| |||  |||||||||||| | |||||||||||||||||| |  |||||    
21779441 tgaggggtaaccttggcgcaactggtgaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggagacagcctcttgtgtaaaaca--gggta 21779344  T
132 aggttgcctacaatacactaaatgatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgcccttttatt 218  Q
    ||||||| |||||||||| ||||| |||||| |||||||||||||||| |||||||||||| ||||| |||  ||||||||||||||    
21779343 aggttgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttttatt 21779257  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 35 - 217
Target Start/End: Original strand, 11514392 - 11514573
Alignment:
35 ggggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaagg 134  Q
    |||||||||| ||| |||||||||||||||||||||||||||| ||||| |||  |||||| ||||| |||||||||||||||||||||| |  ||||||    
11514392 ggggtaaccttggcgcaactggtaaagttgttgtcatgtgactggaaggtcacgggttcaactcctggaaacagcctcttgtgtaaaaaacaaagtaagg 11514491  T
135 ttgcctacaatacactaaatgatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgcccttttat 217  Q
     ||| |||||||||| ||||| |||||| ||||||| ||||||||||||||||||||||||||| |||   ||||||||||||    
11514492 ctgcgtacaatacaccaaatggtgggac-ccttcccagaccctgcgtatgcgggagctttagtgcaccggattgcccttttat 11514573  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 33 - 216
Target Start/End: Original strand, 9671134 - 9671316
Alignment:
33 gaggggtaacctcggcacaactggtaaagttgttgtcatgtgactagaag-gccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggta 131  Q
    |||||||||||| ||| |||| ||||||||||||||||||||||| |||  | |||  |||||| ||||| |||||||||||||||||||| |  |||||    
9671134 gaggggtaaccttggcgcaaccggtaaagttgttgtcatgtgactggaaatgtcacgggttcaaatcctggaaacagcctcttgtgtaaaaca--gggta 9671231  T
132 aggttgcctacaatacactaaatgatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgccctttta 216  Q
    ||| ||| |||||||||| ||||| |||||| ||||||||||||||||||||||||||||||||||| |||  ||||||||||||    
9671232 aggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctttta 9671316  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 31 - 214
Target Start/End: Complemental strand, 25079901 - 25079717
Alignment:
31 ttgaggggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaa-aaaataggg 129  Q
    |||||||||||||| ||| |||||||||||||||||||||||||||| ||||| |||  ||||||||| |  ||||| |||||||||||| |||| | ||    
25079901 ttgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcttagaaacaacctcttgtgtaaaaaaacaagg 25079802  T
130 taaggttgcctacaatacactaaatgatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgcccttt 214  Q
    ||||| ||| ||||||||||  |||| |||||| ||||||||||||||||||||||  ||||||||||| |||  ||||||||||    
25079801 taaggatgcgtacaatacaccgaatggtgggaccccttcccggaccctgcgtatgcaagagctttagtgcaccgggttgcccttt 25079717  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 33 - 216
Target Start/End: Original strand, 5840982 - 5841167
Alignment:
33 gaggggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaa 132  Q
    |||||||||||| ||  ||| || ||||||||||||||||||||| ||||| |||  |||||||||||  ||||||||| ||||||||||||||||||||    
5840982 gaggggtaaccttggtgcaaatgataaagttgttgtcatgtgactggaaggtcacgggttcaagtcctagaaacagccttttgtgtaaaaaatagggtaa 5841081  T
133 ggttgcctacaatacacta--aatgatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgccctttta 216  Q
    || ||| |||||||||  |  |||| |||||| ||||||||||||| || |||||||||||||||||| |||  ||||||||||||    
5841082 ggatgcgtacaatacatcaataatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccgagttgccctttta 5841167  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #9
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 33 - 183
Target Start/End: Complemental strand, 12024099 - 12023950
Alignment:
33 gaggggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaa 132  Q
    |||||||||||| ||| ||||||||||||||||||||||||||||  |||| |||  |||||||||||| ||||||||||||||||| |||| |||||||    
12024099 gaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgta-aaaacagggtaa 12024001  T
133 ggttgcctacaatacactaaatgatgggactccttcccggaccctgcgtat 183  Q
    || ||| |||||||||| ||||| |||||| || |||||||||||||||||    
12024000 ggctgcgtacaatacaccaaatggtgggaccccctcccggaccctgcgtat 12023950  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #10
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 48 - 215
Target Start/End: Original strand, 17667971 - 17668138
Alignment:
48 cacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatac 147  Q
    |||||||||||||||||||||||||||||| ||||| |||  |||||||||||| ||| | |||||||||||||||  ||||||||| ||| ||||||||    
17667971 cacaactggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaagaacctcttgtgtaaaaatcagggtaaggctgcgtacaatac 17668070  T
148 actaaatgatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgccctttt 215  Q
    || ||||| ||| || ||||| || |||||||||||  ||||||||||||| |||  |||||||||||    
17668071 accaaatggtggaaccccttctcgaaccctgcgtatatgggagctttagtgcaccgggttgccctttt 17668138  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #11
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 32 - 214
Target Start/End: Original strand, 23397719 - 23397899
Alignment:
32 tgaggggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggta 131  Q
    ||||||||||||| ||  ||||||||||||||||||||||||||||  |||| ||   |||||||||||| ||||||||||||||||||||  |||||||    
23397719 tgaggggtaaccttggtgcaactggtaaagttgttgtcatgtgactgaaaggtcatgggttcaagtcctggaaacagcctcttgtgtaaaa--tagggta 23397816  T
132 aggttgcctacaatacactaaatgatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgcccttt 214  Q
    ||| | | |||||||||| ||||| |||||| ||||| |||||||| | |||||||||||| ||||| |||  ||||||||||    
23397817 aggctacgtacaatacaccaaatggtgggaccccttctcggaccctacatatgcgggagctctagtgcaccgggttgcccttt 23397899  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #12
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 70 - 215
Target Start/End: Original strand, 14444720 - 14444864
Alignment:
70 atgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacactaaatgatgggactccttcc 169  Q
    |||||||| ||||| |||  |||||||||||| |||||||||||||||||||||  ||||||||| ||  ||| |||||| ||||| |||||| ||||||    
14444720 atgtgactggaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaac-agggtaaggctgtgtacgatacaccaaatggtgggaccccttcc 14444818  T
170 cggaccctgcgtatgcgggagctttagtgtaccatgttgccctttt 215  Q
    ||||||||||||||||||||||||||||| |||| |||||||||||    
14444819 cggaccctgcgtatgcgggagctttagtgcaccaggttgccctttt 14444864  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #13
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 35 - 203
Target Start/End: Complemental strand, 19977893 - 19977725
Alignment:
35 ggggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaagg 134  Q
    |||||||||| |||  ||||||| ||||||||||||||||||   |||| |||  |||||||| ||| |||||||||||| ||||||||||||| |||||    
19977893 ggggtaaccttggcggaactggtgaagttgttgtcatgtgaccgaaaggtcacgggttcaagttctggaaacagcctcttttgtaaaaaataggataagg 19977794  T
135 ttgcctacaatacactaaatgatgggactccttcccggaccctgcgtatgcgggagctttagtgtacca 203  Q
    |||| |||||||||| ||||| |||||  |||||||| ||| || ||||||||||||||||||| ||||    
19977793 ttgcgtacaatacaccaaatggtgggatcccttcccgaaccttgtgtatgcgggagctttagtgcacca 19977725  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #14
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 34 - 215
Target Start/End: Complemental strand, 24200805 - 24200622
Alignment:
34 aggggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaag 133  Q
    ||||||||||| |   ||||||||||||||||||||||||||||  || | |||  |||||||||||| |||||||||||||||||||||| ||||||||    
24200805 aggggtaaccttgatgcaactggtaaagttgttgtcatgtgactgaaaagtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaag 24200706  T
134 gttgcctacaatacac--taaatgatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgccctttt 215  Q
    | ||| ||||||||||   ||||| |||||  ||||||||||||||| ||||| | ||||||||||| |||  |||||||||||    
24200705 gctgcgtacaatacaccaaaaatggtgggaacccttcccggaccctgagtatgtgagagctttagtgcaccgggttgccctttt 24200622  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #15
Raw Score: 76; E-Value: 5e-35
Query Start/End: Original strand, 36 - 215
Target Start/End: Complemental strand, 25249915 - 25249737
Alignment:
36 gggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggt 135  Q
    ||||||||| ||| ||| ||||||||||||||||||||||||  |||| |||  ||||||||| || |||||| |||||||||| |||  |||||||||     
25249915 gggtaaccttggcgcaattggtaaagttgttgtcatgtgactgtaaggtcacgggttcaagtcatggaaacagtctcttgtgtacaaac-agggtaaggc 25249817  T
136 tgcctacaatacactaaatgatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgccctttt 215  Q
    ||| |||||||||| ||||| |||||  |||||||| |||||||||||||| ||||||||||| |||  |||||||||||    
25249816 tgcgtacaatacaccaaatggtgggatcccttcccgaaccctgcgtatgcgtgagctttagtgcaccgggttgccctttt 25249737  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #16
Raw Score: 74; E-Value: 8e-34
Query Start/End: Original strand, 46 - 215
Target Start/End: Original strand, 17623531 - 17623700
Alignment:
46 ggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaat 145  Q
    ||||||||||||||||||||||||||| |||| ||||| |||  |||||||||||  ||||| |||||||||||||||  ||||||||| ||| ||||||    
17623531 ggcacaactggtaaagttgttgtcatgcgactggaaggtcacgggttcaagtcctcgaaacaacctcttgtgtaaaaatcagggtaaggctgcgtacaat 17623630  T
146 acactaaatgatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgccctttt 215  Q
    |||| ||||| ||| || |||||||| | |||||||||| || |||||||||| ||   |||||||||||    
17623631 acaccaaatggtggaaccccttcccgaatcctgcgtatgtggaagctttagtgcactgggttgccctttt 17623700  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #17
Raw Score: 74; E-Value: 8e-34
Query Start/End: Original strand, 35 - 215
Target Start/End: Original strand, 17896215 - 17896396
Alignment:
35 ggggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaa-aatagggtaag 133  Q
    |||||||||| | | |||||||||||||||||||||||||||   |||| |||   ||||||||||  ||||| |||||||||||||| |||||||||||    
17896215 ggggtaaccttgacgcaactggtaaagttgttgtcatgtgaccgaaaggtcacggattcaagtcctagaaacaacctcttgtgtaaaaaaatagggtaag 17896314  T
134 gttgcctacaatacactaaatgatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgccctttt 215  Q
    | ||| ||||||| || ||||| |||||| ||||| ||||||||||||||| ||||||||||||| | |  |||||||||||    
17896315 gctgcgtacaatataccaaatggtgggaccccttctcggaccctgcgtatgtgggagctttagtgcatcgagttgccctttt 17896396  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #18
Raw Score: 74; E-Value: 8e-34
Query Start/End: Original strand, 32 - 183
Target Start/End: Original strand, 22371010 - 22371158
Alignment:
32 tgaggggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggta 131  Q
    ||||||||||||| ||| |||||||||||||||||||||||||||| | ||| |||  |||||||||||| |||||||||| |||   ||||| ||||||    
22371010 tgaggggtaaccttggcccaactggtaaagttgttgtcatgtgactgggaggtcacgggttcaagtcctggaaacagcctcgtgt---aaaaacagggta 22371106  T
132 aggttgcctacaatacactaaatgatgggactccttcccggaccctgcgtat 183  Q
    ||| ||| |||||||||| ||||| |||||| ||||||||||||||| ||||    
22371107 aggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgtgtat 22371158  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #19
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 33 - 195
Target Start/End: Complemental strand, 26684803 - 26684639
Alignment:
33 gaggggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacag-cctcttgtgtaaaaaa-tagggt 130  Q
    |||||||||| |  || |||||||||||||||||||||||||| |  |||| || | ||| ||||||||||||||| |||||||||||||||| || |||    
26684803 gaggggtaactttagcgcaactggtaaagttgttgtcatgtgattgaaaggtcaaaggtttaagtcctgaaaacagacctcttgtgtaaaaaaatatggt 26684704  T
131 aaggttgcctacaatacactaaatgatgggactccttcccggaccctgcgtatgcgggagcttta 195  Q
    |||| ||| ||||||| |||||||| ||||||  ||||||| |||||||||||||||||||||||    
26684703 aaggctgcgtacaatatactaaatggtgggacctcttcccgaaccctgcgtatgcgggagcttta 26684639  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #20
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 55 - 202
Target Start/End: Complemental strand, 4516510 - 4516363
Alignment:
55 ggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacactaaat 154  Q
    |||||||||||||||| ||||||  |||| ||||| ||||||| ||  |||||||||||||||||||||| |||| || | ||| |||||||||| || |    
4516510 ggtaaagttgttgtcacgtgactgaaaggtcacatattcaagttctagaaacagcctcttgtgtaaaaaacagggcaacgctgcgtacaatacaccaatt 4516411  T
155 gatgggactccttcccggaccctgcgtatgcgggagctttagtgtacc 202  Q
    | |||||| ||||||||||||||||||||| || ||||||||||||||    
4516410 ggtgggaccccttcccggaccctgcgtatgtggaagctttagtgtacc 4516363  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #21
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 90 - 215
Target Start/End: Original strand, 10546173 - 10546299
Alignment:
90 gttcaagtcctgaaaacagcctcttgtgtaaaaaat-agggtaaggttgcctacaatacactaaatgatgggactccttcccggaccctgcgtatgcggg 188  Q
    |||||||||||| ||||| |||||||| |||||||  ||||||||| ||| |||||||||| ||||| |||||| |||||||||||||||||||||||||    
10546173 gttcaagtcctggaaacatcctcttgtataaaaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgcggg 10546272  T
189 agctttagtgtaccatgttgccctttt 215  Q
    |||||||||| |||  |||||||||||    
10546273 agctttagtgcaccgggttgccctttt 10546299  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #22
Raw Score: 66; E-Value: 5e-29
Query Start/End: Original strand, 33 - 215
Target Start/End: Original strand, 7214488 - 7214672
Alignment:
33 gaggggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaa 132  Q
    |||||||||| | ||||||||||||||||||||||||||||||||  |||| ||   ||||||||| || |||||| ||||||||||||| | |||||||    
7214488 gaggggtaactttggcacaactggtaaagttgttgtcatgtgactgaaaggtcatgggttcaagtcttggaaacagtctcttgtgtaaaatacagggtaa 7214587  T
133 ggttgcctacaatacac--taaatgatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgccctttt 215  Q
    || ||| ||||||||||   ||||| || ||  ||||| ||||| ||||||||||| ||| ||||||| |||| |||||| ||||    
7214588 ggctgcgtacaatacacaaaaaatggtgagatcccttctcggacactgcgtatgcgagagttttagtgcaccaggttgccttttt 7214672  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #23
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 34 - 214
Target Start/End: Original strand, 14544018 - 14544201
Alignment:
34 aggggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgta-aaaaatagggtaa 132  Q
    ||||||||||| ||| ||| ||||||||||||||||||||||||  ||||  ||| || || || ||| ||||||||||||||||| ||||| |||||||    
14544018 aggggtaaccttggcgcaattggtaaagttgttgtcatgtgactgaaaggttacaggtccaggtactggaaacagcctcttgtgtagaaaaacagggtaa 14544117  T
133 ggttgcctacaata--cactaaatgatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgcccttt 214  Q
    |  ||| | |||||  ||  ||||| | |||| |||||| |||||||||||||||||||||||||||| |||| ||||||||||    
14544118 gactgcgtgcaataaccaaaaaatggtcggaccccttccgggaccctgcgtatgcgggagctttagtgcaccaagttgcccttt 14544201  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #24
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 53 - 216
Target Start/End: Complemental strand, 39914467 - 39914304
Alignment:
53 ctggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaa-aaaatagggtaaggttgcctacaatacacta 151  Q
    ||||||||||||||||||||||||| ||||| |||  | |||||| ||| ||||| |||||||||||| |||| ||||||||| ||  ||||||||||      
39914467 ctggtaaagttgttgtcatgtgactggaaggtcacgggatcaagtactggaaacaacctcttgtgtaaaaaaacagggtaaggatgtgtacaatacaccg 39914368  T
152 aatgatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgccctttta 216  Q
    |||| |||||| |||| || ||||||||||||||||||||||||||| | |  ||||||||||||    
39914367 aatggtgggacccctt-cctgaccctgcgtatgcgggagctttagtgcatcgggttgccctttta 39914304  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #25
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 33 - 149
Target Start/End: Original strand, 17705449 - 17705565
Alignment:
33 gaggggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaa 132  Q
    |||||||||||| ||  |||||||||||||||||||||||||||||||||| |||  |||||||||||| |||| |||||||||||||| || || ||||    
17705449 gaggggtaaccttggtgcaactggtaaagttgttgtcatgtgactagaaggtcacgggttcaagtcctggaaaccgcctcttgtgtaaacaacagagtaa 17705548  T
133 ggttgcctacaatacac 149  Q
    || ||  ||||||||||    
17705549 ggctgtgtacaatacac 17705565  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #26
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 95 - 215
Target Start/End: Original strand, 36871509 - 36871627
Alignment:
95 agtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacactaaatgatgggactccttcccggaccctgcgtatgcgggagcttt 194  Q
    ||||||| |||||||||||||||| ||||  ||||||||| ||| |||||||||| ||||| |||||| |||||||||| ||||||||||||||||||||    
36871509 agtcctggaaacagcctcttgtgtgaaaac-agggtaaggctgcgtacaatacaccaaatggtgggaccccttcccgga-cctgcgtatgcgggagcttt 36871606  T
195 agtgtaccatgttgccctttt 215  Q
    |||| |||  |||||||||||    
36871607 agtgcaccgggttgccctttt 36871627  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #27
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 54 - 214
Target Start/End: Complemental strand, 40417031 - 40416871
Alignment:
54 tggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacactaaa 153  Q
    |||||||||||||||||||||||| ||||| |||  ||||||||| || ||||| |||||||| ||||||| |||| |||| ||  |||||||||| ||     
40417031 tggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcatggaaacaacctcttgtataaaaaacagggaaaggctgtgtacaatacaccaat 40416932  T
154 tgatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgcccttt 214  Q
    ||||||||| | ||   ||||||||| |||||| ||||||||||| |||  ||||||||||    
40416931 tgatgggacccttttttggaccctgcatatgcgagagctttagtgcaccgggttgcccttt 40416871  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #28
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 55 - 194
Target Start/End: Complemental strand, 21377232 - 21377093
Alignment:
55 ggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacactaaat 154  Q
    |||||||||||||||||||||||  ||||  ||  ||||||||| |  ||||| |||||||||||||||| ||||||||| ||  |||||| ||| ||||    
21377232 ggtaaagttgttgtcatgtgactgaaaggttacgagttcaagtcatagaaacatcctcttgtgtaaaaaacagggtaaggctgggtacaatgcaccaaat 21377133  T
155 gatgggactccttcccggaccctgcgtatgcgggagcttt 194  Q
    | |||||| |||||||| |||||||||||| |||||||||    
21377132 ggtgggaccccttcccgaaccctgcgtatgtgggagcttt 21377093  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #29
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 57 - 197
Target Start/End: Complemental strand, 31158598 - 31158456
Alignment:
57 taaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacactaaa--t 154  Q
    |||||||||||||||||||||  |||| ||   ||| ||||| | |||||||||||||| |||||||| |||||||| |||| ||||||| || |||  |    
31158598 taaagttgttgtcatgtgactgaaaggtcaagggttaaagtcttcaaaacagcctcttgcgtaaaaaacagggtaagattgcatacaataaaccaaaaat 31158499  T
155 gatgggactccttcccggaccctgcgtatgcgggagctttagt 197  Q
    | |||||| ||||||| ||||||||||||||||||||||||||    
31158498 ggtgggaccccttcccagaccctgcgtatgcgggagctttagt 31158456  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #30
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 103 - 214
Target Start/End: Complemental strand, 40762345 - 40762234
Alignment:
103 aaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacactaaatgatgggactccttcccggaccctgcgtatgcgggagctttagtgtacc 202  Q
    ||||||||||||||||||||||  |||||||| | | |||||||||| ||||| |||||| | |||| |||||||||||||| ||||||||||||| |||    
40762345 aaacagcctcttgtgtaaaaaactgggtaaggctacgtacaatacaccaaatggtgggaccctttcctggaccctgcgtatgtgggagctttagtgcacc 40762246  T
203 atgttgcccttt 214  Q
      ||||||||||    
40762245 gggttgcccttt 40762234  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #31
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 56 - 201
Target Start/End: Complemental strand, 99421 - 99278
Alignment:
56 gtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacactaaatg 155  Q
    ||||||||||||||| ||||||  |||| |||  |||||||||||  ||||||||||||||  |||||| | || |||| ||| |||||||||| |||||    
99421 gtaaagttgttgtcacgtgactgaaaggtcacgggttcaagtcctagaaacagcctcttgt--aaaaaacatggcaaggctgcgtacaatacaccaaatg 99324  T
156 atgggactccttcccggaccctgcgtatgcgggagctttagtgtac 201  Q
     ||| || ||||| | ||||||| ||||||||||||||||||||||    
99323 gtggaaccccttctcagaccctgtgtatgcgggagctttagtgtac 99278  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #32
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 94 - 203
Target Start/End: Original strand, 30826052 - 30826159
Alignment:
94 aagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacactaaatgatgggactccttcccggaccctgcgtatgcgggagctt 193  Q
    ||||| || |||||||||||||||||||| ||||||||||||||| |||||||||| ||||| ||| || ||||||| |||||| | |||||||||||||    
30826052 aagtcttggaaacagcctcttgtgtaaaa-atagggtaaggttgcgtacaatacaccaaatggtggaac-ccttcccagaccctacatatgcgggagctt 30826149  T
194 tagtgtacca 203  Q
    ||||| ||||    
30826150 tagtgcacca 30826159  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #33
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 90 - 194
Target Start/End: Complemental strand, 32781412 - 32781308
Alignment:
90 gttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacactaaatgatgggactccttcccggaccctgcgtatgcggga 189  Q
    |||||||||  | ||||| |||||||||||||||| ||||||||  ||| |||||||||| ||||| |||||| ||||||| ||||||| ||||||||||    
32781412 gttcaagtctcggaaacaacctcttgtgtaaaaaacagggtaagactgcgtacaatacaccaaatggtgggaccccttcccagaccctgtgtatgcggga 32781313  T
190 gcttt 194  Q
    |||||    
32781312 gcttt 32781308  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #34
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 56 - 211
Target Start/End: Complemental strand, 45235976 - 45235820
Alignment:
56 gtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaa-aatagggtaaggttgcctacaatacactaaat 154  Q
    ||||||||||| ||||||||||  |||  |||  |||||||||||  |||||| ||||| ||||||| |||||||||||| | | |  ||||||| ||||    
45235976 gtaaagttgttctcatgtgactgaaagatcacgagttcaagtcctagaaacagtctcttctgtaaaataatagggtaaggctacgtgtaatacacaaaat 45235877  T
155 gatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgccc 211  Q
    | |||||| |||| || |||||| ||||||| ||||||||||||||||| |||||||    
45235876 ggtgggaccccttaccagaccctacgtatgcaggagctttagtgtaccaagttgccc 45235820  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #35
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 59 - 194
Target Start/End: Complemental strand, 17380391 - 17380257
Alignment:
59 aagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacactaaatgatg 158  Q
    ||||||||||||||||||   |||| |||  ||||||||| || ||||| ||||||||||| |||  ||||||||||||  | |||||||| ||||||||    
17380391 aagttgttgtcatgtgaccgaaaggtcacgggttcaagtcttggaaacaacctcttgtgtataaac-agggtaaggttgtgtgcaatacaccaaatgatg 17380293  T
159 ggactccttcccggaccctgcgtatgcgggagcttt 194  Q
    | || |||||| |||||||||| |||||||||||||    
17380292 gaaccccttcctggaccctgcggatgcgggagcttt 17380257  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #36
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 64 - 198
Target Start/End: Original strand, 25641487 - 25641620
Alignment:
64 gttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacactaaatgatgggact 163  Q
    ||||||||||||||  |||| |||  |||||||||||| ||||||| | |||||| ||||  ||||||| ||||| |||||||||| ||||  ||||||     
25641487 gttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcattttgtgtgaaaac-agggtaaagttgcgtacaatacaccaaattgtgggacc 25641585  T
164 ccttcccggaccctgcgtatgcgggagctttagtg 198  Q
    |||||||| | |||||||||||| |||||||||||    
25641586 ccttcccgaatcctgcgtatgcgagagctttagtg 25641620  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #37
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 114 - 195
Target Start/End: Complemental strand, 31821443 - 31821362
Alignment:
114 tgtgtaaaaaatagggtaaggttgcctacaatacactaaatgatgggactccttcccggaccctgcgtatgcgggagcttta 195  Q
    ||||||||||||||||||||||||  |||||||||| |||||||||||| |||| ||| | |||| ||||||||||||||||    
31821443 tgtgtaaaaaatagggtaaggttgtgtacaatacaccaaatgatgggacccctttccgaaacctgtgtatgcgggagcttta 31821362  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #38
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 50 - 198
Target Start/End: Complemental strand, 24860150 - 24860004
Alignment:
50 caactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacac 149  Q
    ||||||||||| |||||||||||||||| |||||  ||  ||| ||| |||| ||||| ||||| |||||||||  | |||| || ||| ||||||||||    
24860150 caactggtaaaattgttgtcatgtgactggaaggttacgggtttaagccctggaaacaacctctggtgtaaaaac-atggta-ggctgcgtacaatacac 24860053  T
150 taaatgatgggactccttcccggaccctgcgtatgcgggagctttagtg 198  Q
     ||||| | | || ||||| |||||||||||||||||||||||||||||    
24860052 caaatggtagaaccccttctcggaccctgcgtatgcgggagctttagtg 24860004  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #39
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 114 - 214
Target Start/End: Original strand, 25632544 - 25632644
Alignment:
114 tgtgtaaaaaatagggtaaggttgcctacaatacactaaatgatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgccctt 213  Q
    ||||||||||| ||| ||||| ||| |||||||||| ||||| ||||| ||||||||| ||| | |||||||||||||||||||| |||  |||||||||    
25632544 tgtgtaaaaaacaggataaggctgcgtacaatacaccaaatggtgggattccttcccgaaccttacgtatgcgggagctttagtgcaccgggttgccctt 25632643  T
214 t 214  Q
    |    
25632644 t 25632644  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #40
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 39 - 215
Target Start/End: Original strand, 27573581 - 27573756
Alignment:
39 taacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgc 138  Q
    |||||| ||| ||||||||||||||||||||||||||||  |||| ||   |||||||||| |  ||||||||||||||| | ||| | ||||||| |||    
27573581 taaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcattggttcaagtccgggcaacagcctcttgtgt-ataaacatggtaaggctgc 27573679  T
139 ctacaatacactaaatgatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgccctttt 215  Q
     |||||||||| ||||| ||| ||   |||||  |||||| ||||| ||||||||||||| | |  |||||||||||    
27573680 gtacaatacaccaaatggtggaaccatttcccaaaccctgtgtatgtgggagctttagtgcatcgggttgccctttt 27573756  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #41
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 51 - 123
Target Start/End: Original strand, 44604826 - 44604898
Alignment:
51 aactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaa 123  Q
    ||||| ||||||||||||||||||||| ||||| |||| |||||||||||| ||||| |||||||||||||||    
44604826 aactgctaaagttgttgtcatgtgactggaaggtcacaggttcaagtcctggaaacaacctcttgtgtaaaaa 44604898  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #42
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 54 - 216
Target Start/End: Original strand, 44643497 - 44643660
Alignment:
54 tggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaat-agggtaaggttgcctacaatacactaa 152  Q
    ||||||||||||  ||||||||||  |||| ||| ||||||||| ||  ||| ||||||||  ||||||||  || |||||| ||| ||||||  || ||    
44643497 tggtaaagttgtcatcatgtgactgaaaggtcacgtgttcaagttctagaaagagcctcttccgtaaaaaaacagagtaaggctgcgtacaatgtaccaa 44643596  T
153 atgatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgccctttta 216  Q
    ||| |||||| ||||||| |||||||||||||||||||| |||||| |||  | ||||||||||    
44643597 atggtgggaccccttcccagaccctgcgtatgcgggagccttagtgcaccgggctgccctttta 44643660  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #43
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 57 - 177
Target Start/End: Original strand, 5450263 - 5450384
Alignment:
57 taaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgt-aaaaaatagggtaaggttgcctacaatacactaaatg 155  Q
    |||||||||||||||||||||  |||| |||  |||||| ||||| ||||| |||||||||| |||||| | ||||||| ||| |||||||||| ||| |    
5450263 taaagttgttgtcatgtgactgaaaggtcacgggttcaattcctggaaacaacctcttgtgtaaaaaaacatggtaaggctgcgtacaatacaccaaagg 5450362  T
156 atgggactccttcccggaccct 177  Q
     |||||| |||||| |||||||    
5450363 gtgggaccccttcctggaccct 5450384  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #44
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 55 - 176
Target Start/End: Complemental strand, 23145857 - 23145736
Alignment:
55 ggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacactaaat 154  Q
    ||||||||||||||   ||||||  |||| |||  ||||||||| ||||||||| ||||||||||||||| || |||||| ||| |||||||||| || |    
23145857 ggtaaagttgttgtagcgtgactgaaaggtcacgggttcaagtcttgaaaacagactcttgtgtaaaaaacagtgtaaggctgcgtacaatacaccaatt 23145758  T
155 gatgggactccttcccggaccc 176  Q
    | |||||| | |||||||||||    
23145757 ggtgggaccctttcccggaccc 23145736  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #45
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 55 - 176
Target Start/End: Complemental strand, 23557647 - 23557526
Alignment:
55 ggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacactaaat 154  Q
    ||||||||||||||   ||||||  |||| |||  ||||||||| ||||||||| ||||||||||||||| || |||||| ||| |||||||||| || |    
23557647 ggtaaagttgttgtagcgtgactgaaaggtcacgggttcaagtcttgaaaacagactcttgtgtaaaaaacagtgtaaggctgcgtacaatacaccaatt 23557548  T
155 gatgggactccttcccggaccc 176  Q
    | |||||| | |||||||||||    
23557547 ggtgggaccctttcccggaccc 23557526  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #46
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 55 - 194
Target Start/End: Original strand, 33795261 - 33795400
Alignment:
55 ggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctac-aatacactaaa 153  Q
    |||||||||||||||| |||| |  |||| |||  |||||||||| | ||||| ||||||| |||||||| ||||||||| ||| ||| |||||||   |    
33795261 ggtaaagttgttgtcacgtgattgaaaggtcacgggttcaagtcccggaaacaacctcttgggtaaaaaacagggtaaggctgcgtacaaatacac-cta 33795359  T
154 tgatgggactccttcccggaccctgcgtatgcgggagcttt 194  Q
    || |||||| ||||||| ||||||| |||||||||||||||    
33795360 tggtgggaccccttcccagaccctgtgtatgcgggagcttt 33795400  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #47
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 308 - 368
Target Start/End: Original strand, 33847725 - 33847785
Alignment:
308 aaataacttaaaagaccaatatgttacaaacatcaaacttaaaggacctctgatgtaattt 368  Q
    |||||||||||| || |||||||||||||||||||||||||||||||||||  ||||||||    
33847725 aaataacttaaaggaacaatatgttacaaacatcaaacttaaaggacctctagtgtaattt 33847785  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #48
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 312 - 367
Target Start/End: Original strand, 5009468 - 5009523
Alignment:
312 aacttaaaagaccaatatgttacaaacatcaaacttaaaggacctctgatgtaatt 367  Q
    ||||||||||||||||||||||||||| ||||||||||||||||  ||||||||||    
5009468 aacttaaaagaccaatatgttacaaacctcaaacttaaaggacccatgatgtaatt 5009523  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #49
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 119 - 198
Target Start/End: Original strand, 24890451 - 24890530
Alignment:
119 aaaaaatagggtaaggttgcctacaatacactaaatgatgggactccttcccggaccctgcgtatgcgggagctttagtg 198  Q
    |||||| | ||||||| ||| |||||||||| || || |||||| |||||||||||||||||||||| ||||||||||||    
24890451 aaaaaacaaggtaaggctgcatacaatacaccaattggtgggaccccttcccggaccctgcgtatgcaggagctttagtg 24890530  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #50
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 128 - 213
Target Start/End: Complemental strand, 13245181 - 13245096
Alignment:
128 ggtaaggttgcctacaatacactaaatgatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgccctt 213  Q
    ||||||| ||| |||| ||||||||||| |||||| |||||||||||| ||| ||| |||||||||||||||| |  |||||||||    
13245181 ggtaaggctgcgtacattacactaaatggtgggaccccttcccggaccatgcatatacgggagctttagtgtatcgggttgccctt 13245096  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #51
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 151 - 219
Target Start/End: Original strand, 23488555 - 23488623
Alignment:
151 aaatgatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgcccttttattt 219  Q
    ||||| |||||| ||||||||||||||||||||||| ||||||||||| |||  ||||| |||||||||    
23488555 aaatggtgggaccccttcccggaccctgcgtatgcgagagctttagtgcaccgggttgctcttttattt 23488623  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #52
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 159 - 214
Target Start/End: Original strand, 8575975 - 8576030
Alignment:
159 ggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgcccttt 214  Q
    |||| ||||||||||||||||||||| ||||||||||||| |||| ||||||||||    
8575975 ggaccccttcccggaccctgcgtatgtgggagctttagtgcaccaggttgcccttt 8576030  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #53
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 166 - 217
Target Start/End: Original strand, 22371199 - 22371250
Alignment:
166 ttcccggaccctgcgtatgcgggagctttagtgtaccatgttgcccttttat 217  Q
    ||||||||||||||||||||||||||||||||| |||  |||||||||||||    
22371199 ttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttttat 22371250  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #54
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 55 - 133
Target Start/End: Complemental strand, 29420048 - 29419970
Alignment:
55 ggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaag 133  Q
    ||||||||||||||||  |||||  |||| |||  |||||||||||| ||||| |||||||||||||||| ||||||||    
29420048 ggtaaagttgttgtcacatgactgaaaggtcacgagttcaagtcctggaaacaacctcttgtgtaaaaaacagggtaag 29419970  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #55
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 31 - 77
Target Start/End: Complemental strand, 39189604 - 39189558
Alignment:
31 ttgaggggtaacctcggcacaactggtaaagttgttgtcatgtgact 77  Q
    |||||||||||||| ||| ||||||||||||||||||||||||||||    
39189604 ttgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgact 39189558  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #56
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 68 - 204
Target Start/End: Original strand, 19614981 - 19615118
Alignment:
68 tcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacactaa-atgatgggactcct 166  Q
    ||||||||||  |||| |||  |||||||||||  ||||| |||||||| ||||||| ||||||||  ||| ||||||| || || |  |  |||| |||    
19614981 tcatgtgactgaaaggtcacgggttcaagtccttgaaacatcctcttgtataaaaaacagggtaagactgcgtacaatataccaataatagtggacccct 19615080  T
167 tcccggaccctgcgtatgcgggagctttagtgtaccat 204  Q
    ||||| ||||||||||||| |||||||||||| |||||    
19615081 tcccgaaccctgcgtatgcaggagctttagtgcaccat 19615118  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #57
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 157 - 198
Target Start/End: Original strand, 34766333 - 34766374
Alignment:
157 tgggactccttcccggaccctgcgtatgcgggagctttagtg 198  Q
    |||||| |||||||||||||||||||||||||||||||||||    
34766333 tgggaccccttcccggaccctgcgtatgcgggagctttagtg 34766374  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #58
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 157 - 217
Target Start/End: Original strand, 34080179 - 34080239
Alignment:
157 tgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgcccttttat 217  Q
    |||||| |||||||||||||||| |||||||||| ||||||| |||  |||||||||||||    
34080179 tgggaccccttcccggaccctgcatatgcgggagttttagtgcaccgggttgcccttttat 34080239  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #59
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 157 - 213
Target Start/End: Complemental strand, 40579806 - 40579750
Alignment:
157 tgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgccctt 213  Q
    |||||| ||||||||||||||| ||||||||||||||||||| |||  |||||||||    
40579806 tgggaccccttcccggaccctgagtatgcgggagctttagtgcaccgggttgccctt 40579750  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #60
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 90 - 215
Target Start/End: Complemental strand, 15296531 - 15296405
Alignment:
90 gttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacactaaatga-tgggactccttcccggaccctgcgtatgcggg 188  Q
    |||||||||| | ||||||||| |||||||||| | ||||||||| ||| ||||||| || |||  | |||||  ||||| ||||||||||||||| ||     
15296531 gttcaagtcccggaaacagcctgttgtgtaaaatacagggtaaggctgcgtacaatataccaaaatagtgggatcccttctcggaccctgcgtatgtgga 15296432  T
189 agctttagtgtaccatgttgccctttt 215  Q
    |||||| |||  ||| | |||||||||    
15296431 agctttggtgcgccaggctgccctttt 15296405  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #61
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 143 - 201
Target Start/End: Complemental strand, 24059067 - 24059009
Alignment:
143 aatacactaaatgatgggactccttcccggaccctgcgtatgcgggagctttagtgtac 201  Q
    ||||||| | ||| |||||| |||| |||||||||||||||| ||||||||||||||||    
24059067 aatacaccatatggtgggacccctttccggaccctgcgtatgtgggagctttagtgtac 24059009  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #62
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 308 - 354
Target Start/End: Original strand, 25895208 - 25895254
Alignment:
308 aaataacttaaaagaccaatatgttacaaacatcaaacttaaaggac 354  Q
    |||||||||||| ||||||| |||||||||| |||||||||||||||    
25895208 aaataacttaaaggaccaatctgttacaaacctcaaacttaaaggac 25895254  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #63
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 144 - 202
Target Start/End: Original strand, 31525771 - 31525829
Alignment:
144 atacactaaatgatgggactccttcccggaccctgcgtatgcgggagctttagtgtacc 202  Q
    |||||| |||||||||||| | || || |||||||| ||||||||||||||||||||||    
31525771 atacaccaaatgatgggaccctttgccagaccctgcatatgcgggagctttagtgtacc 31525829  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #64
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 103 - 198
Target Start/End: Original strand, 17471572 - 17471669
Alignment:
103 aaacagcctcttgtgt-aaaaaatagggtaaggttgcctacaataca-ctaaatgatgggactccttcccggaccctgcgtatgcgggagctttagtg 198  Q
    |||||||||||||||| |||||| ||| ||||  ||| ||||||| | | |||||||| ||| ||||||| |||||||| |||||||||| |||||||    
17471572 aaacagcctcttgtgtaaaaaaacaggataagactgcgtacaatataccaaaatgatgagaccccttccctgaccctgcctatgcgggagttttagtg 17471669  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #65
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 312 - 369
Target Start/End: Complemental strand, 44556566 - 44556509
Alignment:
312 aacttaaaagaccaatatgttacaaacatcaaacttaaaggacctctgatgtaatttt 369  Q
    |||||||| ||||||| | |||||||| | |||||||||||||||||||| |||||||    
44556566 aacttaaatgaccaatctattacaaaccttaaacttaaaggacctctgatataatttt 44556509  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #66
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 166 - 198
Target Start/End: Complemental strand, 124962 - 124930
Alignment:
166 ttcccggaccctgcgtatgcgggagctttagtg 198  Q
    |||||||||||||||||||||||||||||||||    
124962 ttcccggaccctgcgtatgcgggagctttagtg 124930  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #67
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 308 - 368
Target Start/End: Original strand, 4189045 - 4189105
Alignment:
308 aaataacttaaaagaccaatatgttacaaacatcaaacttaaaggacctctgatgtaattt 368  Q
    |||||||||||| |||| |||| |||||||| ||||||||||| ||| | |||||||||||    
4189045 aaataacttaaaggacctatatattacaaacctcaaacttaaaagacgtttgatgtaattt 4189105  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #68
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 308 - 368
Target Start/End: Complemental strand, 9500950 - 9500890
Alignment:
308 aaataacttaaaagaccaatatgttacaaacatcaaacttaaaggacctctgatgtaattt 368  Q
    |||||||||||| ||||||| ||||||| || | |||||||||||||| ||| ||||||||    
9500950 aaataacttaaaggaccaatctgttacagacctaaaacttaaaggacccctggtgtaattt 9500890  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #69
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 308 - 368
Target Start/End: Original strand, 14166479 - 14166539
Alignment:
308 aaataacttaaaagaccaatatgttacaaacatcaaacttaaaggacctctgatgtaattt 368  Q
    |||||||||||| |||| || | |||||||||||||||||||| |||  ||||||||||||    
14166479 aaataacttaaaggacctatctattacaaacatcaaacttaaatgacacctgatgtaattt 14166539  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #70
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 55 - 195
Target Start/End: Complemental strand, 44521532 - 44521392
Alignment:
55 ggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacactaaat 154  Q
    |||||||||||| ||| ||||||  |||| |||  |||||| || || |||||  ||||||||||||||| | ||||||| ||| || ||||||| ||||    
44521532 ggtaaagttgttatcacgtgactgaaaggtcacgcgttcaaatcttggaaacaatctcttgtgtaaaaaacaaggtaaggctgcatataatacaccaaat 44521433  T
155 gatgggactccttcccggaccctgcgtatgcgggagcttta 195  Q
    |  ||||  ||||||| |||  ||| ||| |||||||||||    
44521432 ggcgggagcccttcccagacattgcatatacgggagcttta 44521392  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #71
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 151 - 198
Target Start/End: Original strand, 4794874 - 4794921
Alignment:
151 aaatgatgggactccttcccggaccctgcgtatgcgggagctttagtg 198  Q
    |||||||||||| |||||||||| ||||| |||||||||||| |||||    
4794874 aaatgatgggaccccttcccggatcctgcatatgcgggagctctagtg 4794921  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #72
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 308 - 351
Target Start/End: Original strand, 5009405 - 5009448
Alignment:
308 aaataacttaaaagaccaatatgttacaaacatcaaacttaaag 351  Q
    |||||||||||| || ||||||||||||||| ||||||||||||    
5009405 aaataacttaaaggatcaatatgttacaaacctcaaacttaaag 5009448  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #73
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 308 - 355
Target Start/End: Complemental strand, 25895010 - 25894963
Alignment:
308 aaataacttaaaagaccaatatgttacaaacatcaaacttaaaggacc 355  Q
    |||||||||||| ||||||| |||||||||  ||||||||||||||||    
25895010 aaataacttaaaggaccaatttgttacaaatctcaaacttaaaggacc 25894963  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #74
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 94 - 193
Target Start/End: Complemental strand, 30864536 - 30864438
Alignment:
94 aagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacactaaatgatgggactccttcccggaccctgcgtatgcgggagctt 193  Q
    ||||| || ||||||||||||||||| |||||||||||||| ||| ||||||| || ||||| |  ||  | |||||  ||||||||||||||| |||||    
30864536 aagtcatggaaacagcctcttgtgta-aaaatagggtaagggtgcgtacaatataccaaatggtaagatcctttcccaaaccctgcgtatgcggaagctt 30864438  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #75
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 120 - 203
Target Start/End: Complemental strand, 39499324 - 39499241
Alignment:
120 aaaaatagggtaaggttgcctacaatacactaaatgatgggactccttcccggaccctgcgtatgcgggagctttagtgtacca 203  Q
    ||||||||||||| | ||| |||||||||  ||||| |||||  ||||  || | |||||||||||||||||||||||| ||||    
39499324 aaaaatagggtaaagctgcgtacaatacatcaaatggtgggatcccttttcgaatcctgcgtatgcgggagctttagtgcacca 39499241  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #76
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 157 - 212
Target Start/End: Original strand, 41409940 - 41409995
Alignment:
157 tgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgccct 212  Q
    |||||| |||||||||||||||| ||||||||||||| |||| |||  ||||||||    
41409940 tgggaccccttcccggaccctgcatatgcgggagcttcagtgcaccgggttgccct 41409995  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #77
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 308 - 355
Target Start/End: Original strand, 43699471 - 43699518
Alignment:
308 aaataacttaaaagaccaatatgttacaaacatcaaacttaaaggacc 355  Q
    |||||| ||||| || ||||||||||||||| ||||||||||||||||    
43699471 aaataaattaaaggatcaatatgttacaaacctcaaacttaaaggacc 43699518  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #78
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 164 - 214
Target Start/End: Complemental strand, 3633758 - 3633708
Alignment:
164 ccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgcccttt 214  Q
    ||||||||||||| || |||||||||||||||||| |||  ||||||||||    
3633758 ccttcccggaccccgcatatgcgggagctttagtgcaccgagttgcccttt 3633708  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #79
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 151 - 197
Target Start/End: Complemental strand, 19185806 - 19185760
Alignment:
151 aaatgatgggactccttcccggaccctgcgtatgcgggagctttagt 197  Q
    ||||| ||| || |||||| |||||||||||||||||||||||||||    
19185806 aaatggtggaaccccttcctggaccctgcgtatgcgggagctttagt 19185760  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #80
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 308 - 353
Target Start/End: Original strand, 29379925 - 29379970
Alignment:
308 aaataacttaaaagaccaatatgttacaaacatcaaacttaaagga 353  Q
    |||||| ||||| ||| |||||||||||||| ||||||||||||||    
29379925 aaataatttaaaggactaatatgttacaaacgtcaaacttaaagga 29379970  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #81
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 56 - 124
Target Start/End: Original strand, 4795730 - 4795798
Alignment:
56 gtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaa 124  Q
    ||||||||||||||| ||||||  || | ||| |||| ||||| ||||||||||||| || ||||||||    
4795730 gtaaagttgttgtcacgtgactgaaaagtcacttgttgaagtcttgaaaacagcctcatgcgtaaaaaa 4795798  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #82
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 33 - 77
Target Start/End: Complemental strand, 27466311 - 27466267
Alignment:
33 gaggggtaacctcggcacaactggtaaagttgttgtcatgtgact 77  Q
    |||| ||||| | ||| ||||||||||||||||||||||||||||    
27466311 gaggcgtaacattggcgcaactggtaaagttgttgtcatgtgact 27466267  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #83
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 55 - 110
Target Start/End: Original strand, 35017793 - 35017849
Alignment:
55 ggtaaagttgttgtcatgtgactag-aaggccacatgttcaagtcctgaaaacagcc 110  Q
    ||||||||||||||||||||||| | |||| |||  ||| |||||||||||||||||    
35017793 ggtaaagttgttgtcatgtgacttgaaaggtcacgggtttaagtcctgaaaacagcc 35017849  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 112; Significance: 2e-56; HSPs: 98)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 112; E-Value: 2e-56
Query Start/End: Original strand, 32 - 215
Target Start/End: Complemental strand, 40272994 - 40272811
Alignment:
32 tgaggggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggta 131  Q
    ||||||||||||| ||| |||||||||||||||||||||||||||| ||||| ||   |||||||||||| ||||| |||||||||||||||| ||||||    
40272994 tgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactggaaggtcatgggttcaagtcctggaaacaacctcttgtgtaaaaaacagggta 40272895  T
132 aggttgcctacaatacactaaatgatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgccctttt 215  Q
    ||| ||| |||||||||| ||||| |||||| ||||||||||||||||||||||||||||||||||| |||  |||||||||||    
40272894 aggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctttt 40272811  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 107; E-Value: 2e-53
Query Start/End: Original strand, 32 - 195
Target Start/End: Complemental strand, 8247871 - 8247706
Alignment:
32 tgaggggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggta 131  Q
    ||||||||||||| ||| ||||||||||||||||||||||||||||  |||| |||  |||||||||||| |||||||||||||||||||||| ||||||    
8247871 tgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggta 8247772  T
132 aggttgcctacaatacacta--aatgatgggactccttcccggaccctgcgtatgcgggagcttta 195  Q
    ||||||| |||||||||| |  |||| |||||||||||||||||||||||||||||||||||||||    
8247771 aggttgcgtacaatacaccaataatggtgggactccttcccggaccctgcgtatgcgggagcttta 8247706  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 102; E-Value: 2e-50
Query Start/End: Original strand, 32 - 217
Target Start/End: Complemental strand, 13628975 - 13628787
Alignment:
32 tgaggggtaacctcggcacaactggtaaa-gttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggt 130  Q
    ||||||||||||| ||||||||||||||| |||||||||||||||||  |||| |||  |||||||||||| |||||||||||||||||| ||| |||||    
13628975 tgaggggtaaccttggcacaactggtaaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaagaaacagggt 13628876  T
131 aaggttgcctacaatacacta--aatgatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgcccttttat 217  Q
    |||| ||| |||||||||| |  |||| |||||| ||||||||||||||||||||||||||||||||||| |||  |||||||||||||    
13628875 aaggctgcgtacaatacaccaataatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttttat 13628787  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 32 - 214
Target Start/End: Original strand, 39203491 - 39203671
Alignment:
32 tgaggggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggta 131  Q
    ||||||||||||| ||||||||| ||||||||||||||||||||||  |||| |||| |||||||||||  ||||||||||||||||  |||| ||||||    
39203491 tgaggggtaaccttggcacaacttgtaaagttgttgtcatgtgactgaaaggtcacaggttcaagtccttgaaacagcctcttgtgt--aaaacagggta 39203588  T
132 aggttgcctacaatacactaaatgatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgcccttt 214  Q
    ||||||| |||||||||| ||||| |||||| |||||||||||| ||| |||||||||||||||||| |||  ||||||||||    
39203589 aggttgcgtacaatacaccaaatggtgggaccccttcccggaccttgcatatgcgggagctttagtgcaccgggttgcccttt 39203671  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 98; E-Value: 4e-48
Query Start/End: Original strand, 33 - 215
Target Start/End: Complemental strand, 13730785 - 13730601
Alignment:
33 gaggggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaa 132  Q
    |||||||||||| ||| |||||||||||||||||||||||||||| ||||| |||  |||||||||||| |||||||||||||||||||||| |||||||    
13730785 gaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaa 13730686  T
133 ggttgcctacaatacacta--aatgatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgccctttt 215  Q
    || ||  |||||||||| |  |||| |||||| ||||||||||||| || |||||||||||||||||| |||  |||||||||||    
13730685 ggctgtgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccgggttgccctttt 13730601  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 98; E-Value: 4e-48
Query Start/End: Original strand, 33 - 195
Target Start/End: Complemental strand, 46421218 - 46421054
Alignment:
33 gaggggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaa 132  Q
    |||||||||||| ||| ||||||||||||||||||||||||||||  |||| |||  |||||||||||| |||||||||||||||||||||| |||||||    
46421218 gaggggtaaccttggcgcaactggtaaagttgttgtcatgtgacttaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaa 46421119  T
133 ggttgcctacaatacacta--aatgatgggactccttcccggaccctgcgtatgcgggagcttta 195  Q
    || ||| |||||||||| |  |||| |||||| ||||||||||||||||||||||||||||||||    
46421118 ggctgcgtacaatacaccaataatggtgggaccccttcccggaccctgcgtatgcgggagcttta 46421054  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 94; E-Value: 9e-46
Query Start/End: Original strand, 34 - 216
Target Start/End: Complemental strand, 29366902 - 29366718
Alignment:
34 aggggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaag 133  Q
    ||||||||||| |||  |||||||||||||||||||||||||||| |||| |||  |||||||||||| |||||||||||||| ||||||| ||||||||    
29366902 aggggtaaccttggcgtaactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctggaaacagcctcttgtataaaaaacagggtaag 29366803  T
134 gttgcctacaatacacta--aatgatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgccctttta 216  Q
    | ||| |||||||||| |  |||| |||||| ||||||||||||||||||||| ||||||||||||| ||   ||||||||||||    
29366802 gctgcgtacaatacaccaataatggtgggaccccttcccggaccctgcgtatgtgggagctttagtgcactgggttgccctttta 29366718  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 88; E-Value: 4e-42
Query Start/End: Original strand, 33 - 216
Target Start/End: Complemental strand, 12914216 - 12914033
Alignment:
33 gaggggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaa 132  Q
    |||||||||||| ||| ||||||||||||||||||| |||||||   |||| |||| |||||||||||| |||||||||||||||||||||| |||||||    
12914216 gaggggtaaccttggcgcaactggtaaagttgttgtaatgtgaccgaaaggtcacaagttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaa 12914117  T
133 ggttgcctacaatacactaaatgatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgccctttta 216  Q
    ||  || |||||||||| ||||| || ||| ||||||| |||||||| ||||||||||||| | || |||  ||||||||||||    
12914116 ggcggcgtacaatacaccaaatggtgagaccccttcccagaccctgcatatgcgggagcttcaatgcaccgggttgccctttta 12914033  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 88; E-Value: 4e-42
Query Start/End: Original strand, 44 - 215
Target Start/End: Original strand, 26869694 - 26869864
Alignment:
44 tcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctaca 143  Q
    ||||| ||||||||||||||||||||||||||||  |||| |||| |||||||||||| ||||||||||| |||| ||||| ||||||||| ||| ||||    
26869694 tcggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacaggttcaagtcctggaaacagcctctggtgt-aaaaacagggtaaggctgcgtaca 26869792  T
144 atacactaaatgatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgccctttt 215  Q
    |||||| ||||| |||||| |||| ||||||| |||||||||||||||||| ||| |||  |||||||||||    
26869793 atacaccaaatggtgggaccccttgccggaccatgcgtatgcgggagctttggtgcaccgggttgccctttt 26869864  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 33 - 215
Target Start/End: Complemental strand, 52926391 - 52926218
Alignment:
33 gaggggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaa 132  Q
    |||||||||||| ||| |||||||||||||||||||||||||||| ||||| |||  |||||||||||| |||||||||||||||||         ||||    
52926391 gaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaacagcctcttgtgta---------gtaa 52926301  T
133 ggttgcctacaatacactaaatgatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgccctttt 215  Q
    || ||| |||||||||| ||||| |||||| ||||||||||||||||||||||||||||||||| | |||  |||||||||||    
52926300 ggctgcgtacaatacaccaaatggtgggacaccttcccggaccctgcgtatgcgggagctttagcgcaccgggttgccctttt 52926218  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #11
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 32 - 215
Target Start/End: Original strand, 1217065 - 1217246
Alignment:
32 tgaggggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggta 131  Q
    ||||||||||||| ||| |||||||||||||||| ||||||| |||  |||| |||  |||||||||||| ||||||||||||||||  |||| ||||||    
1217065 tgaggggtaaccttggcgcaactggtaaagttgtagtcatgtcactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgt--aaaacagggta 1217162  T
132 aggttgcctacaatacactaaatgatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgccctttt 215  Q
    ||| ||| |||||||||| |||||  ||||| |||||||||||||||| |||||||||||| ||||| |||  |||||||||||    
1217163 aggctgcgtacaatacaccaaatggcgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctttt 1217246  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #12
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 31 - 213
Target Start/End: Original strand, 22609741 - 22609921
Alignment:
31 ttgaggggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggt 130  Q
    |||||||||||||| ||| |||| |||||||||||||||||||||||  ||||  ||  ||||||||| || |||||||||||||||||||||  |||||    
22609741 ttgaggggtaaccttggcgcaac-ggtaaagttgttgtcatgtgactgtaaggtaacgggttcaagtcttggaaacagcctcttgtgtaaaaac-agggt 22609838  T
131 aaggttgcctacaatacactaaatgatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgccctt 213  Q
    |||| ||| |||||||||| ||||| |||||| |||||||||||| ||||||||||||||||| |||| |||  |||||||||    
22609839 aaggctgcgtacaatacaccaaatggtgggaccccttcccggaccttgcgtatgcgggagcttcagtgcaccgggttgccctt 22609921  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #13
Raw Score: 79; E-Value: 8e-37
Query Start/End: Original strand, 31 - 217
Target Start/End: Original strand, 16735415 - 16735600
Alignment:
31 ttgaggggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggt 130  Q
    |||||||||||||| ||| ||||||||||||||||||||||||||||  || | |||  |||||||||||  ||||||||||||||  |||||  |||||    
16735415 ttgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaac-agggt 16735513  T
131 aaggttgcctacaatacactaaatgatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgcccttttat 217  Q
    |||| ||| |||||||||| ||||| |||||| ||||||||||| |||||||||||| ||||| |||| ||   |||||||||||||    
16735514 aaggctgcgtacaatacaccaaatggtgggaccccttcccggacactgcgtatgcggtagcttcagtgcactgggttgcccttttat 16735600  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #14
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 33 - 198
Target Start/End: Complemental strand, 6412002 - 6411838
Alignment:
33 gaggggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaa 132  Q
    |||||||||||| | | |||||||||||||||||||||||| |||   ||| ||   ||||||||| || |||||||||||||||||||||  |||||||    
6412002 gaggggtaaccttgacgcaactggtaaagttgttgtcatgtaactgataggtcatgggttcaagtcttgtaaacagcctcttgtgtaaaaac-agggtaa 6411904  T
133 ggttgcctacaatacactaaatgatgggactccttcccggaccctgcgtatgcgggagctttagtg 198  Q
    || ||| |||||||||| |||||||||||| ||||||| |||| ||||||||||||||||||||||    
6411903 ggctgcgtacaatacaccaaatgatgggaccccttcccagaccttgcgtatgcgggagctttagtg 6411838  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #15
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 55 - 212
Target Start/End: Original strand, 26573125 - 26573282
Alignment:
55 ggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacactaaat 154  Q
    |||||||||||||||| ||||||  |||| |||  |||||||||||| |||||||||| ||||||||||| ||||||||| ||| |||||||||| || |    
26573125 ggtaaagttgttgtcacgtgactgaaaggtcacgggttcaagtcctggaaacagcctcctgtgtaaaaaacagggtaaggctgcgtacaatacaccaatt 26573224  T
155 gatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgccct 212  Q
    | |||||| || |||||||||||||||||||| ||||||||||| |||| | ||||||    
26573225 ggtgggaccccatcccggaccctgcgtatgcgtgagctttagtgcaccaggctgccct 26573282  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #16
Raw Score: 74; E-Value: 8e-34
Query Start/End: Original strand, 33 - 162
Target Start/End: Complemental strand, 4495845 - 4495716
Alignment:
33 gaggggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaa 132  Q
    ||||||||||||  || |||||||||||||||||||||||||||| ||||| |||  |||||||||||||||| ||||| |||||||||||| |||||||    
4495845 gaggggtaaccttcgcgcaactggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcctgaaaatagcctattgtgtaaaaaacagggtaa 4495746  T
133 ggttgcctacaatacactaaatgatgggac 162  Q
    || ||| |||||||||| ||||| ||||||    
4495745 ggctgcgtacaatacaccaaatggtgggac 4495716  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #17
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 32 - 197
Target Start/End: Original strand, 9607178 - 9607345
Alignment:
32 tgaggggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggta 131  Q
    ||||||||||||| ||| ||||| ||||||||||||||||||||||  |||| ||   |||||||||||| ||||||||||||| |||||||| ||||||    
9607178 tgaggggtaaccttggcgcaacttgtaaagttgttgtcatgtgactgaaaggtcatcggttcaagtcctggaaacagcctcttgcgtaaaaaacagggta 9607277  T
132 aggttgcctacaatacacta--aatgatgggactccttcccggaccctgcgtatgcgggagctttagt 197  Q
    ||| ||| || ||||||| |  |||| |||||| ||||||| ||||| || |||||||||||||||||    
9607278 aggctgcgtagaatacaccaataatgttgggaccccttcccagaccccgcatatgcgggagctttagt 9607345  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #18
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 56 - 198
Target Start/End: Complemental strand, 34420802 - 34420659
Alignment:
56 gtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaataca-ctaaat 154  Q
    ||||||||||||||| ||||||  |||| |||  |||||||||||| |||||||||||||||||||||| ||||||||| ||| ||| ||||| | ||||    
34420802 gtaaagttgttgtcacgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaaggctgcgtaccatacaccaaaat 34420703  T
155 gatgggactccttcccggaccctgcgtatgcgggagctttagtg 198  Q
    | |||||| |||||||||||| |||||||| |||||||||||||    
34420702 ggtgggaccccttcccggaccttgcgtatgtgggagctttagtg 34420659  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #19
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 30 - 215
Target Start/End: Complemental strand, 5173905 - 5173718
Alignment:
30 tttgaggggtaacctcggcacaactggtaaa-gttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagg 128  Q
    ||||||||||||||| ||| ||||| ||||| |||||||||||||||||  |||| |||  |||||||||||| ||||| ||||||||||| |||| |      
5173905 tttgaggggtaaccttggcgcaactcgtaaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacaacctcttgtgta-aaaacaaa 5173807  T
129 gtaaggttgcctacaatacac--taaatgatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgccctttt 215  Q
    |||||||||| | ||||||||   ||||| |||| | |||||||||||| |||||||||||||||||||||| |||  |||||||||||    
5173806 gtaaggttgcatgcaatacaccaaaaatggtggggccccttcccggaccttgcgtatgcgggagctttagtgcaccgggttgccctttt 5173718  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #20
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 37 - 213
Target Start/End: Complemental strand, 22123092 - 22122918
Alignment:
37 ggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggtt 136  Q
    |||||||| ||| | ||||||||| ||||||||||||||||  |||| | |  |||||||||||| |||||| ||||||||||||| |  |||||||| |    
22123092 ggtaaccttggcgccactggtaaatttgttgtcatgtgactgaaaggtcgcgggttcaagtcctggaaacagtctcttgtgtaaaaca--gggtaaggct 22122995  T
137 gcctacaatacactaaatgatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgccctt 213  Q
    || |||||||||| ||||| |||||| |||||||||||||||| |||||| ||||| ||||| |||  |||||||||    
22122994 gcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgagagctctagtgcaccgggttgccctt 22122918  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #21
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 90 - 214
Target Start/End: Original strand, 31592882 - 31593004
Alignment:
90 gttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacactaaatgatgggactccttcccggaccctgcgtatgcggga 189  Q
    |||||||||||| |||||||||||||||||||| |  |||||||| ||| |||||||||| ||||| ||||||||||||||||||||||| |||||||||    
31592882 gttcaagtcctggaaacagcctcttgtgtaaaaca--gggtaaggctgcgtacaatacaccaaatggtgggactccttcccggaccctgcatatgcggga 31592979  T
190 gctttagtgtaccatgttgcccttt 214  Q
    ||| ||||| |||  ||||||||||    
31592980 gctctagtgcaccgggttgcccttt 31593004  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #22
Raw Score: 69; E-Value: 8e-31
Query Start/End: Original strand, 90 - 198
Target Start/End: Complemental strand, 45948962 - 45948854
Alignment:
90 gttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacactaaatgatgggactccttcccggaccctgcgtatgcggga 189  Q
    |||||| ||||| ||||| |||||||||||||||||||||||||| ||| |||||||||| || || |||||| ||||| ||||||||||||||||||||    
45948962 gttcaattcctggaaacaacctcttgtgtaaaaaatagggtaaggctgcatacaatacaccaattggtgggaccccttctcggaccctgcgtatgcggga 45948863  T
190 gctttagtg 198  Q
    |||||||||    
45948862 gctttagtg 45948854  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #23
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 90 - 214
Target Start/End: Complemental strand, 10795549 - 10795423
Alignment:
90 gttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacactaaa--tgatgggactccttcccggaccctgcgtatgcgg 187  Q
    |||||||||||| |||||||||||||||||||| | ||||||||| ||| |||||||||| |||  || |||||| |||||| |||||||||||||||||    
10795549 gttcaagtcctggaaacagcctcttgtgtaaaagacagggtaaggctgcgtacaatacaccaaaaatggtgggaccccttcctggaccctgcgtatgcgg 10795450  T
188 gagctttagtgtaccatgttgcccttt 214  Q
    |||||| |||| |||| ||||||||||    
10795449 gagcttcagtgcaccaggttgcccttt 10795423  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #24
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 97 - 215
Target Start/End: Original strand, 54484730 - 54484849
Alignment:
97 tcctgaaaacagcctcttgtgtaaaaaat-agggtaaggttgcctacaatacactaaatgatgggactccttcccggaccctgcgtatgcgggagcttta 195  Q
    ||||| ||||||||||||||||||||||  | ||||||| ||| |||||||||| ||||| |||||| ||||||||||||||||||||||||||||||||    
54484730 tcctggaaacagcctcttgtgtaaaaaaacaaggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgcgggagcttta 54484829  T
196 gtgtaccatgttgccctttt 215  Q
    ||| |||  |||||||||||    
54484830 gtgcaccgggttgccctttt 54484849  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #25
Raw Score: 66; E-Value: 5e-29
Query Start/End: Original strand, 31 - 155
Target Start/End: Complemental strand, 7697068 - 7696946
Alignment:
31 ttgaggggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggt 130  Q
    |||||||||||||| ||| ||||||||||||||||||||||||||||| |||| |||  |||||||||||| |||||| |||||||||  |||| |||||    
7697068 ttgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctggaaacagtctcttgtgt--aaaacagggt 7696971  T
131 aaggttgcctacaatacactaaatg 155  Q
    |||| ||| |||||||||| |||||    
7696970 aaggctgcgtacaatacaccaaatg 7696946  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #26
Raw Score: 66; E-Value: 5e-29
Query Start/End: Original strand, 55 - 215
Target Start/End: Complemental strand, 53996725 - 53996564
Alignment:
55 ggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaataca-ctaaa 153  Q
    |||||| |||||||||| |||||  |||| ||| |||||||||| || ||||| |||||||||||||||| ||||||||| ||| ||||||||| | |||    
53996725 ggtaaatttgttgtcatttgactgaaaggtcacgtgttcaagtcgtggaaacaacctcttgtgtaaaaaacagggtaaggctgcttacaatacaccaaaa 53996626  T
154 tgatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgccctttt 215  Q
    || |||||| ||||||| ||| ||||||||| ||||||||||||| |||  | |||||||||    
53996625 tggtgggaccccttccctgacactgcgtatgtgggagctttagtgcaccgggctgccctttt 53996564  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #27
Raw Score: 64; E-Value: 8e-28
Query Start/End: Original strand, 65 - 215
Target Start/End: Original strand, 516417 - 516570
Alignment:
65 ttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaata---cactaaatgatggga 161  Q
    |||||||||||||  |||| |||  |||||||||||| |||||||||||||||||||||| ||||||||| |||  ||||||   ||  |||||  ||||    
516417 ttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaaggctgcgcacaataaaccaaaaaatggcggga 516516  T
162 ctccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgccctttt 215  Q
    | ||||||| ||||||||||||||||||||||||||| |||  |||||||||||    
516517 ccccttccccgaccctgcgtatgcgggagctttagtgcaccgggttgccctttt 516570  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #28
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 34 - 216
Target Start/End: Complemental strand, 25517353 - 25517168
Alignment:
34 aggggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagt--cctgaaaacagcctcttgtgtaaaaaat-agggt 130  Q
    |||| |||||| ||| |||||||||||||||||||||||||||| ||||| |||| | | | |   |||| ||||| ||||||||||||||||  | | |    
25517353 agggataaccttggcgcaactggtaaagttgttgtcatgtgactggaaggtcacaggatgatgggacctggaaacatcctcttgtgtaaaaaaacaagat 25517254  T
131 aaggttgcctacaatacactaaatgatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgccctttta 216  Q
    | || ||| |||||||||| ||||| |||||| |||||||||| ||||||||||| |||||||||||| |||  ||||||||||||    
25517253 atggctgcgtacaatacacaaaatggtgggaccccttcccggatcctgcgtatgctggagctttagtgcaccgggttgccctttta 25517168  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #29
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 80 - 197
Target Start/End: Complemental strand, 54374480 - 54374362
Alignment:
80 aaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaataca-ctaaatgatgggactccttcccggaccctg 178  Q
    |||| |||| ||||||||| || ||||| |||||||||||||||||||||||||| ||| |||||| || | ||||| |||||| |||||||||||||||    
54374480 aaggtcacaggttcaagtcttggaaacaacctcttgtgtaaaaaatagggtaaggctgcgtacaatccaccaaaatggtgggaccccttcccggaccctg 54374381  T
179 cgtatgcgggagctttagt 197  Q
    | |||||||||||||||||    
54374380 catatgcgggagctttagt 54374362  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #30
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 90 - 198
Target Start/End: Original strand, 14986990 - 14987100
Alignment:
90 gttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacacta--aatgatgggactccttcccggaccctgcgtatgcgg 187  Q
    |||||||||||| |||||||||||||||||||||| ||||||||| ||| |||||||||| |  |||| |||||| | |||||||||| ||| |||||||    
14986990 gttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaataatggtgggacccattcccggaccttgcatatgcgg 14987089  T
188 gagctttagtg 198  Q
    |||||||||||    
14987090 gagctttagtg 14987100  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #31
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 59 - 194
Target Start/End: Complemental strand, 30928302 - 30928167
Alignment:
59 aagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacactaaatgatg 158  Q
    ||||| |||||||||||||  |||| |||  |||||||||||| |||||||||||||||||||||| | ||||||||||  || ||||||| || ||  |    
30928302 aagttcttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacaaggtaaggttgtgtaaaatacaccaattggcg 30928203  T
159 ggactccttcccggaccctgcgtatgcgggagcttt 194  Q
    |||| |||||||||||||||| |||| |||||||||    
30928202 ggaccccttcccggaccctgcatatgtgggagcttt 30928167  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #32
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 102 - 214
Target Start/End: Complemental strand, 45786328 - 45786214
Alignment:
102 aaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacactaaa--tgatgggactccttcccggaccctgcgtatgcgggagctttagtgt 199  Q
    ||||||||||||||||||||||| ||||||||| ||| |||||||||| |||  || |||||| ||||||||||||||||| |||| ||||||||||||     
45786328 aaaacagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaaaaatggtgggaccccttcccggaccctgcgaatgctggagctttagtgc 45786229  T
200 accatgttgcccttt 214  Q
    |||  ||||||||||    
45786228 accgggttgcccttt 45786214  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #33
Raw Score: 59; E-Value: 7e-25
Query Start/End: Original strand, 60 - 198
Target Start/End: Original strand, 7942993 - 7943131
Alignment:
60 agttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacactaaatgatgg 159  Q
    |||||||||||||||||| ||||| |||   ||||||||||| ||||||| |||||| ||||||| ||||||||  ||| |||||||||  ||||| |||    
7942993 agttgttgtcatgtgactggaaggtcacggattcaagtcctggaaacagcatcttgtctaaaaaacagggtaagactgcgtacaatacatcaaatggtgg 7943092  T
160 gactccttcccggaccctgcgtatgcgggagctttagtg 198  Q
    ||  |||| || |||| ||||||||||||||||||||||    
7943093 gatccctttccagaccatgcgtatgcgggagctttagtg 7943131  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #34
Raw Score: 59; E-Value: 7e-25
Query Start/End: Original strand, 33 - 123
Target Start/End: Complemental strand, 10870132 - 10870042
Alignment:
33 gaggggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaa 123  Q
    |||||||||||| ||| ||||||||||||||||||||||||||||  |||| |||  |||||||||||| |||||||||||||||||||||    
10870132 gaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaa 10870042  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #35
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 103 - 215
Target Start/End: Complemental strand, 49013586 - 49013472
Alignment:
103 aaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacacta--aatgatgggactccttcccggaccctgcgtatgcgggagctttagtgta 200  Q
    |||||||||||||||||||||| ||||||||| ||| |||||||||| |  |||| |||||| ||||||||||||| || || ||||||||||||||| |    
49013586 aaacagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatacgcgggagctttagtgca 49013487  T
201 ccatgttgccctttt 215  Q
    ||  |||||||||||    
49013486 ccgggttgccctttt 49013472  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #36
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 56 - 215
Target Start/End: Original strand, 25944468 - 25944628
Alignment:
56 gtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacactaaa-t 154  Q
    ||||||||||||||| ||||||  |||| ||   |||||||||||| |||| |||||| ||||||||||  ||| |||| ||  |||||||||| ||| |    
25944468 gtaaagttgttgtcacgtgactgaaaggtcatgggttcaagtcctggaaaccgcctctcgtgtaaaaaactgggcaaggctgagtacaatacaccaaaat 25944567  T
155 gatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgccctttt 215  Q
    | |||||| ||||||| ||||||||||||| ||||||||||| | |||| | |||||||||    
25944568 ggtgggaccccttccctgaccctgcgtatgtgggagctttagcgcaccaggctgccctttt 25944628  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #37
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 90 - 198
Target Start/End: Complemental strand, 43114994 - 43114884
Alignment:
90 gttcaagtcctgaaaacagcctcttgtgtaa-aaaatagggtaa-ggttgcctacaatacactaaatgatgggactccttcccgga-ccctgcgtatgcg 186  Q
    |||||||||||| |||||||||||||||||| |||| ||||||| || | |||||||||||| ||||| |||||| |||||| ||| |||||||||||||    
43114994 gttcaagtcctggaaacagcctcttgtgtaaaaaaacagggtaagggctacctacaatacaccaaatggtgggac-ccttcctggacccctgcgtatgcg 43114896  T
187 ggagctttagtg 198  Q
    ||||||||||||    
43114895 ggagctttagtg 43114884  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #38
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 106 - 215
Target Start/End: Original strand, 15797271 - 15797378
Alignment:
106 cagcctcttgtgtaaaaaatagggtaaggttgcctacaatacactaaatgatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatg 205  Q
    ||||||||||||||||| |  |||||||| ||| |||||||||| ||||| |||||| |||||||||||||||| |||| ||||||| ||||| |||  |    
15797271 cagcctcttgtgtaaaaca--gggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgtgggagctctagtgcaccggg 15797368  T
206 ttgccctttt 215  Q
    ||||||||||    
15797369 ttgccctttt 15797378  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #39
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 55 - 200
Target Start/End: Original strand, 28904941 - 28905086
Alignment:
55 ggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaa-aatagggtaaggttgcctacaatacactaaa 153  Q
    |||||||||||||||||||||||| || | |||||||| |||||| |  ||||| ||||||||||||| || | ||||||  ||  |||| ||||| |||    
28904941 ggtaaagttgttgtcatgtgactaaaaagtcacatgtttaagtccagggaacagtctcttgtgtaaaataacaaggtaagactgtgtacattacaccaaa 28905040  T
154 tgatgggactccttcccggaccctgcgtatgcgggagctttagtgta 200  Q
    | ||||||| | ||||||||||||||||| |||||| ||||||||||    
28905041 t-atgggaccctttcccggaccctgcgtaagcgggaactttagtgta 28905086  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #40
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 53 - 213
Target Start/End: Original strand, 33235526 - 33235687
Alignment:
53 ctggtaaagttgttgtcatgtgac-tagaaggccacatgttcaagtcctgaaaacagcctcttgtgt-aaaaaatagggtaaggttgcctacaatacact 150  Q
    |||||||||||||||||||||||| |  |||| |||| |||||| || || ||| |||||||||||| |||||| ||||||||  ||  |||||||||||    
33235526 ctggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaagagcctcttgtgtaaaaaaacagggtaagactgtgtacaatacact 33235625  T
151 aaatgatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgccctt 213  Q
    ||||| |||||| || || | |||| | ||||||||| |||||||||| |||| |||||||||    
33235626 aaatggtgggac-ccctcgcagaccttacgtatgcggaagctttagtgcaccaggttgccctt 33235687  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #41
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 106 - 195
Target Start/End: Original strand, 9276313 - 9276401
Alignment:
106 cagcctcttgtgtaaaaaatagggtaaggttgcctacaatacactaaatgatgggactccttcccggaccctgcgtatgcgggagcttta 195  Q
    ||||||||||||||||||| ||||||||| ||| |||||||||| ||||| | |||| | |||||||||||||||||||||||| |||||    
9276313 cagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaaatggt-ggaccctttcccggaccctgcgtatgcgggaacttta 9276401  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #42
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 68 - 216
Target Start/End: Complemental strand, 54032705 - 54032569
Alignment:
68 tcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacactaaatgatgggactcctt 167  Q
    |||||||||| ||||| |||  |||||||||||| ||||| |||||||||||||||| ||||||||| ||| ||||||||||  |||| ||             
54032705 tcatgtgactggaaggtcacgggttcaagtcctggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccgaatggtg--------- 54032615  T
168 cccggaccctgcgtatgcgggagctttagtgtaccatgttgccctttta 216  Q
       |||||||||||||||||||||||||||| |||  ||||||||||||    
54032614 ---ggaccctgcgtatgcgggagctttagtgcaccgggttgccctttta 54032569  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #43
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 121 - 215
Target Start/End: Complemental strand, 34771457 - 34771363
Alignment:
121 aaaatagggtaaggttgcctacaatacactaaatgatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgccctttt 215  Q
    |||| ||||||||| ||| |||||||||| ||||| |||||| |||||||||||||||| |||||||||||| ||||| |||  | |||||||||    
34771457 aaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggctgccctttt 34771363  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #44
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 32 - 215
Target Start/End: Original strand, 12525385 - 12525565
Alignment:
32 tgaggggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggta 131  Q
    ||||||||||||| ||| ||||||||||||||||   ||| |||||  |||| |||| |||| ||||||| |||||||||||||||||||||  ||||||    
12525385 tgaggggtaaccttggcgcaactggtaaagttgt---catatgactgaaaggtcacaggttcgagtcctggaaacagcctcttgtgtaaaaatcagggta 12525481  T
132 aggttgcctacaatacactaaatgatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgccctttt 215  Q
    ||| |||  |  | ||   ||||| |||||| ||||||  ||||||| |||| ||||||||| | || |||| ||||| |||||    
12525482 aggctgcgaagtacaccaaaaatggtgggacaccttcctagaccctgtgtatacgggagcttcactgcaccaggttgctctttt 12525565  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #45
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 93 - 198
Target Start/End: Original strand, 19731038 - 19731143
Alignment:
93 caagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacactaaatgatgggactccttcccggaccctgcgtatgcgggagct 192  Q
    ||||||||| ||| |||||||||||||||||| | ||||||||||| ||||||||||  | || |||||| | ||||| ||| ||| |||||| ||||||    
19731038 caagtcctggaaatagcctcttgtgtaaaaaacaaggtaaggttgcgtacaatacacctattggtgggaccctttcccagactctgtgtatgcaggagct 19731137  T
193 ttagtg 198  Q
    ||||||    
19731138 ttagtg 19731143  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #46
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 90 - 198
Target Start/End: Original strand, 33926116 - 33926224
Alignment:
90 gttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacacta-aatgatgggactccttcccggaccctgcgtatgcggg 188  Q
    |||||||||||| ||| |||||||||||||||||  ||||||||| ||  |||||||||| | |||| |||||| |||||| ||||||||| |||||| |    
33926116 gttcaagtcctggaaatagcctcttgtgtaaaaac-agggtaaggctgtgtacaatacaccataatggtgggaccccttcctggaccctgcatatgcgag 33926214  T
189 agctttagtg 198  Q
    ||||||||||    
33926215 agctttagtg 33926224  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #47
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 102 - 183
Target Start/End: Original strand, 47624087 - 47624167
Alignment:
102 aaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacactaaatgatgggactccttcccggaccctgcgtat 183  Q
    ||||||||||||||||||||||  ||||||||| ||| |||||||||| ||||| |||||| ||||||||||||||| ||||    
47624087 aaaacagcctcttgtgtaaaaac-agggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgtgtat 47624167  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #48
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 90 - 194
Target Start/End: Original strand, 55401209 - 55401314
Alignment:
90 gttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaataca-ctaaatgatgggactccttcccggaccctgcgtatgcggg 188  Q
    |||||||||||| |||||||||||||||||||||| ||| ||||  ||| || |||||| | ||||| |||||| ||||| |||||| | ||||||||||    
55401209 gttcaagtcctgtaaacagcctcttgtgtaaaaaacaggttaagactgcgtataatacaccaaaatggtgggaccccttctcggaccttccgtatgcggg 55401308  T
189 agcttt 194  Q
    ||||||    
55401309 agcttt 55401314  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #49
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 115 - 212
Target Start/End: Complemental strand, 353450 - 353351
Alignment:
115 gtgtaaaaaatagggtaaggttgcctacaatacactaa--atgatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgccct 212  Q
    |||||||||| ||||||||| ||| |||||||||| ||  ||| |||||| ||||||||||||| || |||||||||||||||||| |||  ||||||||    
353450 gtgtaaaaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccgggttgccct 353351  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #50
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 55 - 198
Target Start/End: Complemental strand, 44403715 - 44403571
Alignment:
55 ggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatac-actaaa 153  Q
    ||||||||| |||||| ||| ||| |||| |||| ||| ||||||||  || |||||||||||||||| | | ||||||| |||  | ||||| || |||    
44403715 ggtaaagttattgtcacgtggctaaaaggtcacaggttaaagtcctgggaatagcctcttgtgtaaaagacaaggtaaggctgcggagaataccacaaaa 44403616  T
154 tgatgggactccttcccggaccctgcgtatgcgggagctttagtg 198  Q
    || |||||| |||||||||||||| ||||||| | ||||||||||    
44403615 tggtgggaccccttcccggaccctacgtatgctgaagctttagtg 44403571  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #51
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 103 - 215
Target Start/End: Complemental strand, 50625064 - 50624952
Alignment:
103 aaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacactaaatgatgggactccttcccggaccctgcgtatgcgggagctttagtgtacc 202  Q
    ||||||||||||||||| |||| |||||||||| || |||||||||| |  || |||||| |||||| || ||||||||| | ||||||||||||| |||    
50625064 aaacagcctcttgtgtataaaaaagggtaaggtagcgtacaatacaccatttggtgggacgccttcctgggccctgcgtaagtgggagctttagtgcacc 50624965  T
203 atgttgccctttt 215  Q
      | |||||||||    
50624964 gggctgccctttt 50624952  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #52
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 55 - 131
Target Start/End: Original strand, 53062036 - 53062112
Alignment:
55 ggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggta 131  Q
    |||||||||||||||||||||||  |||| ||| ||||||||||||| |||||||||| ||||| ||||| ||||||    
53062036 ggtaaagttgttgtcatgtgactgaaaggtcacgtgttcaagtcctggaaacagcctcctgtgtcaaaaacagggta 53062112  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #53
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 55 - 149
Target Start/End: Complemental strand, 45620988 - 45620893
Alignment:
55 ggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaa-aaaatagggtaaggttgcctacaatacac 149  Q
    |||||||||||||||| ||||||  |||| |||  |||||||| ||| |||||||||||||||||| |||| ||||||||| ||| ||||||||||    
45620988 ggtaaagttgttgtcacgtgactgaaaggtcacgggttcaagttctggaaacagcctcttgtgtaaaaaaacagggtaaggctgcgtacaatacac 45620893  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #54
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 151 - 201
Target Start/End: Original strand, 10300585 - 10300635
Alignment:
151 aaatgatgggactccttcccggaccctgcgtatgcgggagctttagtgtac 201  Q
    |||||||||||||||||||| |||||| ||||||||||||||||| |||||    
10300585 aaatgatgggactccttcccagaccctacgtatgcgggagctttaatgtac 10300635  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #55
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 159 - 217
Target Start/End: Complemental strand, 10484671 - 10484613
Alignment:
159 ggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgcccttttat 217  Q
    |||| |||||| |||||||||||||||||||||||||||| |||  |||||||||||||    
10484671 ggaccccttcctggaccctgcgtatgcgggagctttagtgcaccgggttgcccttttat 10484613  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #56
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 90 - 198
Target Start/End: Complemental strand, 829567 - 829458
Alignment:
90 gttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacactaaa-tgatgggactccttcccggaccctgcgtatgcggg 188  Q
    |||||||| ||  ||||| |||||||| |||| || |  |||| ||||| |||||||||| ||| || |||||| |||||||| ||||||||||||| ||    
829567 gttcaagttctagaaacaacctcttgtctaaagaacatagtaaagttgcgtacaatacaccaaaatggtgggaccccttcccgaaccctgcgtatgcagg 829468  T
189 agctttagtg 198  Q
    ||||||||||    
829467 agctttagtg 829458  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #57
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 36 - 159
Target Start/End: Original strand, 21874999 - 21875116
Alignment:
36 gggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgt-aaaaaatagggtaagg 134  Q
    ||||||||| | | |||||||||||||||||||||||||||| || ||      |||||| | ||| ||||| |||||||||| |||||| |||||||||    
21874999 gggtaaccttgacgcaactggtaaagttgttgtcatgtgact-gacgg------gttcaaattctggaaacaacctcttgtgttaaaaaagagggtaagg 21875091  T
135 ttgcctacaatacactaaatgatgg 159  Q
     ||| ||||||||||||||| ||||    
21875092 ctgcgtacaatacactaaataatgg 21875116  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #58
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 93 - 154
Target Start/End: Original strand, 29106585 - 29106646
Alignment:
93 caagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacactaaat 154  Q
    |||||| |||||||| |||||||||||||||||||| ||||||| | |||||||||| ||||    
29106585 caagtcttgaaaacaacctcttgtgtaaaaaataggataaggttacgtacaatacaccaaat 29106646  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #59
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 68 - 194
Target Start/End: Complemental strand, 45139624 - 45139497
Alignment:
68 tcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacac--taaatgatgggactcc 165  Q
    ||||||||||  |||| |||  ||||||||  || ||||| |||||||||||||| | ||||||||| ||| ||||||||||   ||||| |||||| ||    
45139624 tcatgtgactgaaaggtcacgggttcaagttttggaaacaacctcttgtgtaaaacacagggtaaggctgcatacaatacaccaaaaatggtgggacccc 45139525  T
166 ttcccggaccctgcgtatgcgggagcttt 194  Q
    ||||| || ||||||||||||||| ||||    
45139524 ttcccaga-cctgcgtatgcgggaacttt 45139497  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #60
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 166 - 215
Target Start/End: Original strand, 47624208 - 47624257
Alignment:
166 ttcccggaccctgcgtatgcgggagctttagtgtaccatgttgccctttt 215  Q
    ||||||||||||||||||||||||||||||||| |||  |||||||||||    
47624208 ttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctttt 47624257  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #61
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 151 - 215
Target Start/End: Complemental strand, 24851364 - 24851300
Alignment:
151 aaatgatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgccctttt 215  Q
    ||||| |||||| |||||||||| ||||| |||||||||||||||||| |||  |||||||||||    
24851364 aaatggtgggaccccttcccggatcctgcatatgcgggagctttagtgcaccgggttgccctttt 24851300  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #62
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 157 - 217
Target Start/End: Original strand, 30452895 - 30452955
Alignment:
157 tgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgcccttttat 217  Q
    |||||| |||||||||||||||| |||||||||||| ||||| |||  |||||||||||||    
30452895 tgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttttat 30452955  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #63
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 308 - 368
Target Start/End: Original strand, 39541461 - 39541521
Alignment:
308 aaataacttaaaagaccaatatgttacaaacatcaaacttaaaggacctctgatgtaattt 368  Q
    |||||||||||| || ||||  ||||||||| |||||||||||||||| ||||||||||||    
39541461 aaataacttaaaggatcaatccgttacaaacctcaaacttaaaggacccctgatgtaattt 39541521  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #64
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 308 - 368
Target Start/End: Complemental strand, 47573740 - 47573680
Alignment:
308 aaataacttaaaagaccaatatgttacaaacatcaaacttaaaggacctctgatgtaattt 368  Q
    |||||| ||||| ||| |||||||||||||| ||||||||||||||||  |||||||||||    
47573740 aaataatttaaaggactaatatgttacaaacctcaaacttaaaggacccatgatgtaattt 47573680  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #65
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 140 - 215
Target Start/End: Original strand, 24578008 - 24578083
Alignment:
140 tacaatacactaaatgatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgccctttt 215  Q
    |||||||||||||||| |||||||| ||||| |||||| | ||||||||| || ||||| |||  |||||||||||    
24578008 tacaatacactaaatggtgggactctttcccagaccctacatatgcgggaactctagtgcaccgggttgccctttt 24578083  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #66
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 308 - 367
Target Start/End: Original strand, 26976528 - 26976587
Alignment:
308 aaataacttaaaagaccaatatgttacaaacatcaaacttaaaggacctctgatgtaatt 367  Q
    |||||||||||| |||  ||||||||||||  |||||||||||||||| |||||||||||    
26976528 aaataacttaaaggacttatatgttacaaagctcaaacttaaaggacccctgatgtaatt 26976587  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #67
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 308 - 367
Target Start/End: Original strand, 28814090 - 28814149
Alignment:
308 aaataacttaaaagaccaatatgttacaaacatcaaacttaaaggacctctgatgtaatt 367  Q
    |||||||||||||||| ||| | |||||||| ||||| |||||||||| |||||||||||    
28814090 aaataacttaaaagactaatctattacaaacctcaaatttaaaggacccctgatgtaatt 28814149  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #68
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 308 - 355
Target Start/End: Complemental strand, 47069573 - 47069526
Alignment:
308 aaataacttaaaagaccaatatgttacaaacatcaaacttaaaggacc 355  Q
    |||||||||||| |||||||||||||||||| ||||| ||||||||||    
47069573 aaataacttaaaggaccaatatgttacaaacctcaaatttaaaggacc 47069526  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #69
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 96 - 213
Target Start/End: Complemental strand, 31904975 - 31904857
Alignment:
96 gtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacactaaatgatgggactcc-ttcccggaccctgcgtatgcgggagcttt 194  Q
    |||||| ||||||||| || ||||||||| |||||| |  ||| |||||||||| ||||| |||||| || ||||| || | | ||| ||||||||||||    
31904975 gtcctggaaacagcctattatgtaaaaaacagggtatgactgcgtacaatacaccaaatggtgggacccccttcccagatcttacgtgtgcgggagcttt 31904876  T
195 agtgtaccatgttgccctt 213  Q
    |||| |||| | |||||||    
31904875 agtgcaccaggctgccctt 31904857  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #70
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 308 - 354
Target Start/End: Original strand, 32186705 - 32186751
Alignment:
308 aaataacttaaaagaccaatatgttacaaacatcaaacttaaaggac 354  Q
    ||||||||||||| | ||||||||||||||| |||||||||||||||    
32186705 aaataacttaaaacatcaatatgttacaaacctcaaacttaaaggac 32186751  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #71
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 55 - 129
Target Start/End: Original strand, 35417914 - 35417988
Alignment:
55 ggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaataggg 129  Q
    |||||||||||| ||||||||||   ||| |||  |||||| ||||| |||||||||||||||||||||| ||||    
35417914 ggtaaagttgttatcatgtgactgagaggtcacgagttcaaatcctggaaacagcctcttgtgtaaaaaacaggg 35417988  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #72
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 308 - 354
Target Start/End: Original strand, 40286479 - 40286525
Alignment:
308 aaataacttaaaagaccaatatgttacaaacatcaaacttaaaggac 354  Q
    |||||||| ||||||||||| |||||||||| |||||||||||||||    
40286479 aaataactcaaaagaccaatctgttacaaacctcaaacttaaaggac 40286525  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #73
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 308 - 354
Target Start/End: Original strand, 50332725 - 50332771
Alignment:
308 aaataacttaaaagaccaatatgttacaaacatcaaacttaaaggac 354  Q
    ||||||||||||||| |||| | ||||||||||||||||||||||||    
50332725 aaataacttaaaagatcaatttattacaaacatcaaacttaaaggac 50332771  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #74
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 308 - 353
Target Start/End: Original strand, 13903036 - 13903081
Alignment:
308 aaataacttaaaagaccaatatgttacaaacatcaaacttaaagga 353  Q
    |||||||||||||||| |||||||||||||| ||| ||||||||||    
13903036 aaataacttaaaagactaatatgttacaaacctcagacttaaagga 13903081  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #75
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 93 - 198
Target Start/End: Original strand, 19751614 - 19751719
Alignment:
93 caagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacactaaatgatgggactccttcccggaccctgcgtatgcgggagct 192  Q
    ||||||||| ||| |||||||||||||||||  | ||||||||||| ||||||||||  | || |||||| | ||||| |||  || ||||||  |||||    
19751614 caagtcctggaaatagcctcttgtgtaaaaatcaaggtaaggttgcgtacaatacacctattggtgggaccctttcccagactttgtgtatgcatgagct 19751713  T
193 ttagtg 198  Q
    ||||||    
19751714 ttagtg 19751719  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #76
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 171 - 215
Target Start/End: Complemental strand, 4495719 - 4495675
Alignment:
171 ggaccctgcgtatgcgggagctttagtgtaccatgttgccctttt 215  Q
    |||||||||||||||||||||||||||| |||  |||||||||||    
4495719 ggaccctgcgtatgcgggagctttagtgcaccgggttgccctttt 4495675  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #77
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 308 - 368
Target Start/End: Complemental strand, 32186507 - 32186448
Alignment:
308 aaataacttaaaagaccaatatgttacaaacatcaaacttaaaggacctctgatgtaattt 368  Q
    ||||| |||||| ||||||||| |||||||| |||||||||||||||| ||||||| ||||    
32186507 aaatagcttaaaggaccaatatattacaaacctcaaacttaaaggacc-ctgatgttattt 32186448  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #78
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 308 - 356
Target Start/End: Complemental strand, 45131484 - 45131436
Alignment:
308 aaataacttaaaagaccaatatgttacaaacatcaaacttaaaggacct 356  Q
    |||||||||||| || |||| |||||||||| |||||||||||||||||    
45131484 aaataacttaaatgatcaatctgttacaaacctcaaacttaaaggacct 45131436  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #79
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 308 - 368
Target Start/End: Original strand, 47891412 - 47891472
Alignment:
308 aaataacttaaaagaccaatatgttacaaacatcaaacttaaaggacctctgatgtaattt 368  Q
    |||||||||||| || |||| |||||||||  ||||||||||||||||  |||||||||||    
47891412 aaataacttaaaggatcaatttgttacaaatttcaaacttaaaggacccttgatgtaattt 47891472  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #80
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 312 - 367
Target Start/End: Complemental strand, 3377069 - 3377014
Alignment:
312 aacttaaaagaccaatatgttacaaacatcaaacttaaaggacctctgatgtaatt 367  Q
    |||||||| |||| || |||||||||| ||||||||||||||||| || |||||||    
3377069 aacttaaaggacctatctgttacaaacgtcaaacttaaaggacctgtggtgtaatt 3377014  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #81
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 308 - 350
Target Start/End: Original strand, 7607718 - 7607759
Alignment:
308 aaataacttaaaagaccaatatgttacaaacatcaaacttaaa 350  Q
    ||||||||||||| | |||||||||||||||||||||||||||    
7607718 aaataacttaaaa-atcaatatgttacaaacatcaaacttaaa 7607759  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #82
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 308 - 354
Target Start/End: Complemental strand, 14964934 - 14964889
Alignment:
308 aaataacttaaaagaccaatatgttacaaacatcaaacttaaaggac 354  Q
    |||||||||||| ||||||| |||||||||| |||||||||||||||    
14964934 aaataacttaaatgaccaatctgttacaaac-tcaaacttaaaggac 14964889  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #83
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 308 - 358
Target Start/End: Complemental strand, 26976421 - 26976371
Alignment:
308 aaataacttaaaagaccaatatgttacaaacatcaaacttaaaggacctct 358  Q
    |||||||||| | |||| || |||||||||| |||||||||||||||||||    
26976421 aaataacttagaggacctatctgttacaaacctcaaacttaaaggacctct 26976371  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #84
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 308 - 354
Target Start/End: Complemental strand, 40286343 - 40286297
Alignment:
308 aaataacttaaaagaccaatatgttacaaacatcaaacttaaaggac 354  Q
    |||||||||||| || |||||||||| |||| |||||||||||||||    
40286343 aaataacttaaaggaacaatatgttataaacctcaaacttaaaggac 40286297  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #85
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 173 - 215
Target Start/End: Original strand, 40390357 - 40390399
Alignment:
173 accctgcgtatgcgggagctttagtgtaccatgttgccctttt 215  Q
    |||||||||||||||||||||||||| |||  |||||||||||    
40390357 accctgcgtatgcgggagctttagtgcaccgggttgccctttt 40390399  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #86
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 313 - 355
Target Start/End: Original strand, 47069766 - 47069808
Alignment:
313 acttaaaagaccaatatgttacaaacatcaaacttaaaggacc 355  Q
    ||||||| ||||||| |||||||||| ||||||||||||||||    
47069766 acttaaatgaccaatctgttacaaacctcaaacttaaaggacc 47069808  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #87
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 308 - 354
Target Start/End: Original strand, 47891352 - 47891398
Alignment:
308 aaataacttaaaagaccaatatgttacaaacatcaaacttaaaggac 354  Q
    |||||||||||| |||||||||||| ||||| ||||||| |||||||    
47891352 aaataacttaaaggaccaatatgttgcaaacctcaaactcaaaggac 47891398  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #88
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 107 - 215
Target Start/End: Original strand, 26292382 - 26292488
Alignment:
107 agcctcttgtgtaaaaaatagggtaaggttgcctacaatacactaaatgatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgt 206  Q
    |||||||||||||||| |  |||||||   || ||| |||||| |||||||||||  |||||||| ||||||| ||||||||| || ||||| |||  ||    
26292382 agcctcttgtgtaaaaca--gggtaagaccgcgtacgatacaccaaatgatgggatcccttcccgaaccctgcatatgcgggaactctagtgcaccgggt 26292479  T
207 tgccctttt 215  Q
    || ||||||    
26292480 tgtcctttt 26292488  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #89
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 36 - 157
Target Start/End: Original strand, 26782345 - 26782466
Alignment:
36 gggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggt 135  Q
    ||||||||| | | ||| |||||||||| |||||||| || |  |||| |||   ||||||||||  |||||  ||||||||||||||||||||||| |     
26782345 gggtaaccttgacgcaattggtaaagttattgtcatgcgattgaaaggtcacggattcaagtccttgaaacaatctcttgtgtaaaaaatagggtaatgc 26782444  T
136 tgcctacaatacactaaatgat 157  Q
    ||  || ||||||| |||||||    
26782445 tgtataaaatacaccaaatgat 26782466  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #90
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 103 - 155
Target Start/End: Original strand, 31831245 - 31831295
Alignment:
103 aaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacactaaatg 155  Q
    ||||||||||||||||||||  |||||||||| ||| |||||||||| |||||    
31831245 aaacagcctcttgtgtaaaa--tagggtaaggctgcatacaatacaccaaatg 31831295  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #91
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 315 - 367
Target Start/End: Original strand, 3382500 - 3382552
Alignment:
315 ttaaaagaccaatatgttacaaacatcaaacttaaaggacctctgatgtaatt 367  Q
    ||||| |||| || |||||||||| |||||||||||| |||| ||||||||||    
3382500 ttaaaggacctatctgttacaaacgtcaaacttaaagaacctgtgatgtaatt 3382552  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #92
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 322 - 354
Target Start/End: Complemental strand, 5442156 - 5442124
Alignment:
322 accaatatgttacaaacatcaaacttaaaggac 354  Q
    |||||||||||| ||||||||||||||||||||    
5442156 accaatatgttataaacatcaaacttaaaggac 5442124  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #93
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 32 - 72
Target Start/End: Original strand, 9276249 - 9276289
Alignment:
32 tgaggggtaacctcggcacaactggtaaagttgttgtcatg 72  Q
    ||||||||||||| ||| ||||| |||||||||||||||||    
9276249 tgaggggtaaccttggcgcaactagtaaagttgttgtcatg 9276289  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #94
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 308 - 368
Target Start/End: Original strand, 21696600 - 21696659
Alignment:
308 aaataacttaaaagaccaatatgttacaaacatcaaacttaaaggacctctgatgtaattt 368  Q
    ||||||||||||  |||||| ||| |||||| | |||||||||||||| ||||||||||||    
21696600 aaataacttaaagtaccaatttgtcacaaacgtgaaacttaaaggacc-ctgatgtaattt 21696659  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #95
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 308 - 368
Target Start/End: Complemental strand, 25848332 - 25848272
Alignment:
308 aaataacttaaaagaccaatatgttacaaacatcaaacttaaaggacctctgatgtaattt 368  Q
    |||||||||||| || |||| | |||||||  |||||||||||||| ||||| ||||||||    
25848332 aaataacttaaaggatcaatttattacaaatctcaaacttaaaggatctctggtgtaattt 25848272  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #96
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 96 - 203
Target Start/End: Original strand, 31672732 - 31672840
Alignment:
96 gtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacactaaatgatgggactc-cttcccggaccctgcgtatgcgggagcttt 194  Q
    |||||| ||||||||| || ||||||||| | || |||  ||| |||||||||| ||||| |||||||| ||||||  | | | ||| ||||||||||||    
31672732 gtcctggaaacagcctattatgtaaaaaacaaggcaagagtgcgtacaatacaccaaatggtgggactctcttcccatatcttacgtgtgcgggagcttt 31672831  T
195 agtgtacca 203  Q
    |||| ||||    
31672832 agtgcacca 31672840  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #97
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 165 - 213
Target Start/End: Complemental strand, 45288104 - 45288056
Alignment:
165 cttcccggaccctgcgtatgcgggagctttagtgtaccatgttgccctt 213  Q
    |||||||||||||||||||||  ||||||||||| |||| | |||||||    
45288104 cttcccggaccctgcgtatgcaagagctttagtgcaccaggctgccctt 45288056  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #98
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 106 - 154
Target Start/End: Complemental strand, 52428585 - 52428537
Alignment:
106 cagcctcttgtgtaaaaaatagggtaaggttgcctacaatacactaaat 154  Q
    ||||||||||||||||| | ||||||||| ||| |||||||||| ||||    
52428585 cagcctcttgtgtaaaatacagggtaaggctgcgtacaatacaccaaat 52428537  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0057 (Bit Score: 110; Significance: 3e-55; HSPs: 4)
Name: scaffold0057
Description:

Target: scaffold0057; HSP #1
Raw Score: 110; E-Value: 3e-55
Query Start/End: Original strand, 54 - 215
Target Start/End: Original strand, 46806 - 46967
Alignment:
54 tggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacactaaa 153  Q
    |||||||||||||||||||||||||||||| |||  |||||||| ||| ||||| |||||||||||||||||||||||||||||| |||||||||| |||    
46806 tggtaaagttgttgtcatgtgactagaaggtcacgggttcaagtgctggaaacaacctcttgtgtaaaaaatagggtaaggttgcgtacaatacaccaaa 46905  T
154 tgatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgccctttt 215  Q
    || |||||| ||||||||||||||||||||||||||||||||||| |||  |||||||||||    
46906 tggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctttt 46967  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0057; HSP #2
Raw Score: 84; E-Value: 9e-40
Query Start/End: Original strand, 32 - 215
Target Start/End: Complemental strand, 24949 - 24771
Alignment:
32 tgaggggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggta 131  Q
    ||||||||||||| ||| ||||||||||||||||||||||||||||  |||| ||   |||||||||     ||||||||||||||||||||| ||||||    
24949 tgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcatgggttcaagtc-----aacagcctcttgtgtaaaaaacagggta 24855  T
132 aggttgcctacaatacactaaatgatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgccctttt 215  Q
    ||| ||| ||||| |||| ||||| |||||| |||||||| |||||||||||||||||||||||||| | |  |||||||||||    
24854 aggctgcgtacaacacaccaaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcagccggttgccctttt 24771  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0057; HSP #3
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 92 - 217
Target Start/End: Original strand, 43672 - 43796
Alignment:
92 tcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacactaaatgatgggactccttcc-cggaccctgcgtatgcgggag 190  Q
    |||||| ||| ||||||| |||||||||||| |   ||||||| ||| |||||||||| ||||| |||||| |||| | |||||||||| ||||||||||    
43672 tcaagttctggaaacagcgtcttgtgtaaaacaa--ggtaaggctgcgtacaatacaccaaatggtgggacccctttctcggaccctgcatatgcgggag 43769  T
191 ctttagtgtaccatgttgcccttttat 217  Q
    || ||||| ||   |||||||||||||    
43770 ctctagtgcactgagttgcccttttat 43796  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0057; HSP #4
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 126 - 195
Target Start/End: Complemental strand, 46796 - 46726
Alignment:
126 agggtaaggttgcctacaatacactaaa-tgatgggactccttcccggaccctgcgtatgcgggagcttta 195  Q
    ||||||||| ||| ||||||| || ||| || |||||| ||||||| ||||||||||||||||||||||||    
46796 agggtaaggatgcatacaatataccaaaatggtgggaccccttcccagaccctgcgtatgcgggagcttta 46726  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 107; Significance: 2e-53; HSPs: 94)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 107; E-Value: 2e-53
Query Start/End: Original strand, 33 - 215
Target Start/End: Complemental strand, 46248134 - 46247952
Alignment:
33 gaggggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaa 132  Q
    |||||||||||| ||| ||||||||||||||||||||||||||||  || | |||  ||||||||| || |||||||||||||||||||||| |||||||    
46248134 gaggggtaaccttggctcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaagtcttggaaacagcctcttgtgtaaaaaacagggtaa 46248035  T
133 ggttgcctacaatacactaaatgatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgccctttt 215  Q
    |  ||| |||||||||| ||||| |||||| |||||||||||||||||||||||||||||||||||||||  |||||||||||    
46248034 gactgcgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgtaccgggttgccctttt 46247952  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 103; E-Value: 4e-51
Query Start/End: Original strand, 36 - 198
Target Start/End: Complemental strand, 23768498 - 23768336
Alignment:
36 gggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggt 135  Q
    ||||||||||| | ||||||||||||||||||||||||||||  |||| |||| ||||||||| || |||||||||||||||||||||| |||||||||     
23768498 gggtaacctcgacgcaactggtaaagttgttgtcatgtgactgtaaggtcacaggttcaagtcatggaaacagcctcttgtgtaaaaaacagggtaaggc 23768399  T
136 tgcctacaatacactaaatgatgggactccttcccggaccctgcgtatgcgggagctttagtg 198  Q
    ||| |||||||||| ||||| |||||| ||||||| |||||||||||||||||||||||||||    
23768398 tgcgtacaatacaccaaatggtgggacaccttcccagaccctgcgtatgcgggagctttagtg 23768336  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 103; E-Value: 4e-51
Query Start/End: Original strand, 32 - 217
Target Start/End: Complemental strand, 34725278 - 34725095
Alignment:
32 tgaggggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggta 131  Q
    ||||||||||||| ||| ||||||||||||||||||||||||||||  |||| |||  |||||||||||| ||||||||||||||||  |||| ||||||    
34725278 tgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgt--aaaacagggta 34725181  T
132 aggttgcctacaatacactaaatgatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgcccttttat 217  Q
    ||| ||| |||||||||||||||| |||||| |||||||||||||||| |||||||||||| ||||| |||  |||||||||||||    
34725180 aggctgcgtacaatacactaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttttat 34725095  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 99; E-Value: 1e-48
Query Start/End: Original strand, 33 - 215
Target Start/End: Original strand, 18944620 - 18944805
Alignment:
33 gaggggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaa 132  Q
    |||||||||||| ||| ||||||||||||||||||||||||||||  |||| |||| ||||||| |||| |||||||||||||||||||||| |||||||    
18944620 gaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacaggttcaaggcctggaaacagcctcttgtgtaaaaaacagggtaa 18944719  T
133 ggttgcctacaatacacta--aatgatgggactccttcccggaccctgcgtatgcgggagc-tttagtgtaccatgttgccctttt 215  Q
    || ||| |||||||||| |  |||| |||||| |||||||||||||||||||||||||||| ||||||| |||  |||||||||||    
18944720 ggctgcgtacaatacaccaacaatggtgggaccccttcccggaccctgcgtatgcgggagcttttagtgcaccgggttgccctttt 18944805  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 97; E-Value: 2e-47
Query Start/End: Original strand, 32 - 216
Target Start/End: Original strand, 14617014 - 14617198
Alignment:
32 tgaggggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggta 131  Q
    ||||||||||||| ||| |||| |||||||||||||||||||||||  |||| |||  |||||||||||| ||||||||||||||||||| || | ||||    
14617014 tgaggggtaaccttggcgcaaccggtaaagttgttgtcatgtgactgaaaggtcacgagttcaagtcctggaaacagcctcttgtgtaaataacaaggta 14617113  T
132 aggttgcctacaatacactaaatgatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgccctttta 216  Q
    ||||||| |||||||||| ||||| |||||  |||||||||||||||| |||||||||||||||||| |||  ||| ||||||||    
14617114 aggttgcgtacaatacaccaaatggtgggatcccttcccggaccctgcatatgcgggagctttagtgcaccgggttaccctttta 14617198  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 96; E-Value: 6e-47
Query Start/End: Original strand, 39 - 219
Target Start/End: Complemental strand, 30395903 - 30395721
Alignment:
39 taacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgc 138  Q
    |||||| ||| ||||||||||||||||||||||||||||  |||| |||  |||||||||||| |||||||||||||||||||||| ||||||||| |||    
30395903 taaccttggcgcaactggtaaagttgttgtcatgtgactttaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaaggctgc 30395804  T
139 ctacaatacacta--aatgatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgcccttttattt 219  Q
     |||||||||| |  |||| |||||| ||||||||||||| || |||||||||||||||||| |||  |||||||||||||||    
30395803 gtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccgagttgcccttttattt 30395721  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 33 - 211
Target Start/End: Original strand, 46991781 - 46991959
Alignment:
33 gaggggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaa 132  Q
    |||||||||||| ||  |||||||||||||||||||||||||||| ||||| |||  |||||||||||| ||||| |||||||||||||||| |||||||    
46991781 gaggggtaaccttggtgcaactggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaacaacctcttgtgtaaaaaacagggtaa 46991880  T
133 ggttgcctacaatacactaaatgatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgccc 211  Q
    || ||  ||||||||||  |||| |||||| ||||||||||||||||||||| ||||||||||||| |||  |||||||    
46991881 ggctgtgtacaatacaccgaatggtgggaccccttcccggaccctgcgtatgtgggagctttagtgcaccgggttgccc 46991959  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 94; E-Value: 9e-46
Query Start/End: Original strand, 31 - 216
Target Start/End: Complemental strand, 41319989 - 41319804
Alignment:
31 ttgaggggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggt 130  Q
    |||||||||||||| | ||||||||||||||||||||||||||||||  |||| |||| ||| |||||||| |||||| ||||||||||||||| |||||    
41319989 ttgaggggtaaccttgacacaactggtaaagttgttgtcatgtgactgaaaggtcacaggtttaagtcctggaaacagtctcttgtgtaaaaaacagggt 41319890  T
131 aaggttgcctacaatacactaaatgatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgccctttta 216  Q
    |||| ||| |||||||||| |||||||||||| |||||||| ||||| | |||||||||| || |||| ||   ||||||||||||    
41319889 aaggctgcgtacaatacaccaaatgatgggaccccttcccgaacccttcatatgcgggagtttcagtgcactgggttgccctttta 41319804  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 52 - 215
Target Start/End: Original strand, 6925096 - 6925259
Alignment:
52 actggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacacta 151  Q
    |||||||||||||||||||||||||| ||||| |||  |||||||||||| ||| |||||||||||||||||||||||||||| |||  |||||||||      
6925096 actggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaatagcctcttgtgtaaaaaatagggtaaggctgcggacaatacaccg 6925195  T
152 aatgatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgccctttt 215  Q
    |||| |||||| ||||||||| ||||||||||||||||||||||||| |||  |||||| ||||    
6925196 aatggtgggaccccttcccggtccctgcgtatgcgggagctttagtgcaccgagttgccttttt 6925259  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #10
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 33 - 218
Target Start/End: Original strand, 10668197 - 10668389
Alignment:
33 gaggggtaacctcggcacaactggtaaagttgttgtcatgtga-----ctagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatag 127  Q
    |||||||||||| ||| ||||||||||||||||||||||||||     ||  |||| |||  |||||||||||| |||||||||||||||||||||| |     
10668197 gaggggtaaccttggcgcaactggtaaagttgttgtcatgtgatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacaa 10668296  T
128 ggtaaggttgcctacaatacacta--aatgatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgcccttttatt 218  Q
    ||||||||||| |||||||||| |  |||| |||||| ||||||||| ||||||||||||||||||||||||| |||  ||||||||||||||    
10668297 ggtaaggttgcgtacaatacaccaataatggtgggaccccttcccggtccctgcgtatgcgggagctttagtgcaccgggttgcccttttatt 10668389  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #11
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 32 - 217
Target Start/End: Original strand, 27474257 - 27474441
Alignment:
32 tgaggggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggta 131  Q
    |||||||||||||  || ||||||||||||||||||||||||||||  |||| |||| ||||||||| || |||||| ||||||||| ||||| |||| |    
27474257 tgaggggtaaccttagctcaactggtaaagttgttgtcatgtgactgaaaggtcacaggttcaagtcttggaaacagtctcttgtgt-aaaaacagggca 27474355  T
132 aggttgcctacaatacactaaatgatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgcccttttat 217  Q
    | | ||| ||||||||||| |||| |||||| ||||||||||||||||||||||||||||||||||| |||   ||||||||||||    
27474356 aagctgcgtacaatacactgaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccggattgcccttttat 27474441  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #12
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 33 - 218
Target Start/End: Complemental strand, 32632737 - 32632553
Alignment:
33 gaggggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaa 132  Q
    |||||||||||| ||| |||||||||||||||||||||| |||||  |||| |||  |||||||||||| ||||||||||||||||| |||| |||||||    
32632737 gaggggtaaccttggcgcaactggtaaagttgttgtcatatgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgta-aaaacagggtaa 32632639  T
133 ggttgcctacaatacactaaatgatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgcccttttatt 218  Q
    || ||| |||||||||| ||||| |||||| |||||||  ||||||| ||||||||||||| |||| |||| ||| ||||||||||    
32632638 ggctgcgtacaatacaccaaatggtgggaccccttcccaaaccctgcatatgcgggagcttgagtgcaccaggtttcccttttatt 32632553  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #13
Raw Score: 89; E-Value: 9e-43
Query Start/End: Original strand, 33 - 218
Target Start/End: Complemental strand, 20004273 - 20004086
Alignment:
33 gaggggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaa 132  Q
    |||||||||||| ||  |||||||||||||||||||||||||||| ||||| |||  |||||||||||| ||||||||||| |||||||||| | |||||    
20004273 gaggggtaaccttggtgcaactggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaacagcctctcgtgtaaaaaacaaggtaa 20004174  T
133 ggttgcctacaatacacta--aatgatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgcccttttatt 218  Q
    || ||| |||||||||| |  |||| |||||| ||||||| ||||| || |||||||||||||||||| |||  ||||||||||||||    
20004173 ggctgcgtacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgcccttttatt 20004086  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #14
Raw Score: 84; E-Value: 9e-40
Query Start/End: Original strand, 33 - 215
Target Start/End: Complemental strand, 45812716 - 45812536
Alignment:
33 gaggggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaa 132  Q
    |||||||||||| ||| |||||| |||||||||||||||||||||  |||| |||| ||||||||||||||||||| |||||||||  |||| |||||||    
45812716 gaggggtaaccttggcgcaactgataaagttgttgtcatgtgactgaaaggtcacaggttcaagtcctgaaaacagtctcttgtgt--aaaagagggtaa 45812619  T
133 ggttgcctacaatacactaaatgatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgccctttt 215  Q
    || ||| |||||||||| ||||| |||||| |||||||  ||||||| |||||||||||| ||||| |||  |||||| ||||    
45812618 ggctgcatacaatacaccaaatggtgggaccccttcccaaaccctgcatatgcgggagctctagtgcaccgggttgccttttt 45812536  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #15
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 33 - 203
Target Start/End: Original strand, 47214488 - 47214656
Alignment:
33 gaggggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaa 132  Q
    |||||||||| | ||| ||||||||||||||||||||||||||||  |||| |||  |||||||||||| |||||| ||||||| ||||| |  ||||||    
47214488 gaggggtaactttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagtctcttgtttaaaaca--gggtaa 47214585  T
133 ggttgcctacaatacactaaatgatgggactccttcccggaccctgcgtatgcgggagctttagtgtacca 203  Q
    |||||| |||||||||| ||||| |||||| ||||||| |||||||| |||||||||||| ||||| ||||    
47214586 ggttgcgtacaatacaccaaatggtgggaccccttcccagaccctgcatatgcgggagctctagtgcacca 47214656  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #16
Raw Score: 76; E-Value: 5e-35
Query Start/End: Original strand, 55 - 194
Target Start/End: Complemental strand, 18724704 - 18724565
Alignment:
55 ggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacactaaat 154  Q
    |||||||||||||||||||||||  |||| |||  |||||||||||| |||||||||||||||||||||| ||||||||| ||  |||||||||| ||||    
18724704 ggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaaggctgtgtacaatacaccaaat 18724605  T
155 gatgggactccttcccggaccctgcgtatgcgggagcttt 194  Q
      |||||| |||||||||||||| | ||||||||||||||    
18724604 cttgggaccccttcccggaccctacatatgcgggagcttt 18724565  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #17
Raw Score: 76; E-Value: 5e-35
Query Start/End: Original strand, 33 - 215
Target Start/End: Complemental strand, 38478461 - 38478281
Alignment:
33 gaggggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaa 132  Q
    |||||||||||| ||| ||||| ||||| ||||||||||||||||  |||| |||  |||||||||||  ||||||||||||||||  |||| |||||||    
38478461 gaggggtaaccttggcgcaactagtaaacttgttgtcatgtgactgaaaggtcacgggttcaagtcctagaaacagcctcttgtgt--aaaacagggtaa 38478364  T
133 ggttgcctacaatacactaaatgatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgccctttt 215  Q
    || ||| |||||||||| ||||| ||| || ||||| |||||||||| |||||||||||| ||||| |||  |||||||||||    
38478363 ggctgcgtacaatacaccaaatggtggaaccccttctcggaccctgcatatgcgggagctctagtgcaccgggttgccctttt 38478281  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #18
Raw Score: 74; E-Value: 8e-34
Query Start/End: Original strand, 32 - 198
Target Start/End: Original strand, 27201623 - 27201791
Alignment:
32 tgaggggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggta 131  Q
    |||||||||||||  ||  || ||||||||||||||||||||||||  |||| ||   |||||||||||| |||||||||||||||| | ||| ||||||    
27201623 tgaggggtaaccttagcgtaaatggtaaagttgttgtcatgtgactgaaaggtcatgggttcaagtcctggaaacagcctcttgtgtcagaaacagggta 27201722  T
132 aggttgcctacaatacac--taaatgatgggactccttcccggaccctgcgtatgcgggagctttagtg 198  Q
    ||| ||| ||||||||||   ||||| |||||| |||||||||||| ||||||||||||||||||||||    
27201723 aggctgcgtacaatacaccaaaaatggtgggaccccttcccggaccttgcgtatgcgggagctttagtg 27201791  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #19
Raw Score: 74; E-Value: 8e-34
Query Start/End: Original strand, 90 - 216
Target Start/End: Original strand, 35005157 - 35005285
Alignment:
90 gttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacac--taaatgatgggactccttcccggaccctgcgtatgcgg 187  Q
    ||||||||| ||||||||||||||||||||||||| ||||||||| ||| ||||||||||   ||||| |||||| ||||||||||||||||||||||||    
35005157 gttcaagtcttgaaaacagcctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaaaaatggtgggaccccttcccggaccctgcgtatgcgg 35005256  T
188 gagctttagtgtaccatgttgccctttta 216  Q
    | ||||||||| |||  ||||||||||||    
35005257 gcgctttagtgcaccgggttgccctttta 35005285  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #20
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 32 - 215
Target Start/End: Original strand, 8197019 - 8197202
Alignment:
32 tgaggggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggta 131  Q
    ||||||||||||| ||  |||||||| |||||||||||||||||||  |||| |||  ||||||||||||  ||  ||||||||||||||||| | ||||    
8197019 tgaggggtaaccttggtgcaactggtcaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggtaattgcctcttgtgtaaaaaacatggta 8197118  T
132 aggttgcctacaatacactaaatgatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgccctttt 215  Q
    ||| | | |||| ||||| ||||| | |||| ||||| |||||||||||||||  ||||||||||||||||  |||||||||||    
8197119 aggctacgtacagtacaccaaatggtaggaccccttctcggaccctgcgtatgttggagctttagtgtaccgggttgccctttt 8197202  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #21
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 38 - 211
Target Start/End: Original strand, 45402077 - 45402251
Alignment:
38 gtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggt--aaggt 135  Q
    ||||||| ||| |||||||||||||||||||||||||| | |||||  ||  |||||||||||| |||||||||||||||||||||  |||||  ||| |    
45402077 gtaaccttggcgcaactggtaaagttgttgtcatgtga-tggaaggtaacgggttcaagtcctggaaacagcctcttgtgtaaaaac-agggttcaagtt 45402174  T
136 -tgcctacaatacactaaatgatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgccc 211  Q
     ||| |||||||||| ||||| |||||| ||||||| ||||||||||||||||||||||||||| |||  |||||||    
45402175 ctgcgtacaatacaccaaatggtgggaccccttcccagaccctgcgtatgcgggagctttagtgcaccgggttgccc 45402251  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #22
Raw Score: 66; E-Value: 5e-29
Query Start/End: Original strand, 54 - 218
Target Start/End: Complemental strand, 6983969 - 6983807
Alignment:
54 tggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacactaaa 153  Q
    ||||||||||||||||| ||||||  |||| |||| |||||||||||| ||||||||||  || ||||||| ||||||||  ||| |||||||||| |||    
6983969 tggtaaagttgttgtcacgtgactgaaaggtcacaggttcaagtcctggaaacagcctc--gtataaaaaacagggtaagtatgcgtacaatacaccaaa 6983872  T
154 tgatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgcccttttatt 218  Q
    || |||||| |||| |||||||||||||| || |||||||| ||| |||  | ||||||||||||    
6983871 tggtgggacccctttccggaccctgcgtaggcaggagctttggtgcaccgggctgcccttttatt 6983807  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #23
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 56 - 192
Target Start/End: Complemental strand, 25468421 - 25468285
Alignment:
56 gtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacactaaatg 155  Q
    |||||||||||||||||||| |  |||| ||   |||||||||||| ||||| |||||||||||||||  ||||||||||||| |||||||||| |||||    
25468421 gtaaagttgttgtcatgtgattgaaaggtcatgggttcaagtcctggaaacaacctcttgtgtaaaaatcagggtaaggttgcgtacaatacaccaaatg 25468322  T
156 atgggactccttcccggaccctgcgtatgcgggagct 192  Q
     | ||||  |||||| |||||||||||||||||||||    
25468321 gttggacctcttcccagaccctgcgtatgcgggagct 25468285  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #24
Raw Score: 64; E-Value: 8e-28
Query Start/End: Original strand, 55 - 198
Target Start/End: Complemental strand, 35117927 - 35117781
Alignment:
55 ggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacac--taa 152  Q
    |||||||||||||||| ||||||  |||| |||  |||||||||||| ||| |||||||||||||||| | ||||||||| ||  ||||||||||   ||    
35117927 ggtaaagttgttgtcacgtgactgaaaggtcacgggttcaagtcctggaaatagcctcttgtgtaaaatacagggtaaggctgtgtacaatacaccaaaa 35117828  T
153 atgatgggactccttcccggaccctgcgt-atgcgggagctttagtg 198  Q
    |||||||||| |||||||||||||||||| |||| ||||||||||||    
35117827 atgatgggaccccttcccggaccctgcgtaatgcaggagctttagtg 35117781  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #25
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 33 - 179
Target Start/End: Complemental strand, 22930248 - 22930104
Alignment:
33 gaggggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaa 132  Q
    |||||||||||| ||| ||||||||||||||||||||||||||||  |||| ||   |||||||||||| ||||||||| |||||| ||||| |||||||    
22930248 gaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcatgggttcaagtcctggaaacagccttttgtgt-aaaaacagggtaa 22930150  T
133 ggttgcctacaatacactaaatgatgggactccttcccggaccctgc 179  Q
    |||||   ||||||||| ||||| |||||| |||||| |||||||||    
22930149 ggttg-tgacaatacaccaaatggtgggaccccttcctggaccctgc 22930104  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #26
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 117 - 214
Target Start/End: Original strand, 4349699 - 4349796
Alignment:
117 gtaaaaaatagggtaaggttgcctacaatacactaaatgatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgcccttt 214  Q
    |||||||| ||||||||| ||| |||||||||| ||||| |||||| ||||||||||||||||||||||||||||||||||| |||  ||||||||||    
4349699 gtaaaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttt 4349796  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #27
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 55 - 198
Target Start/End: Complemental strand, 2435946 - 2435802
Alignment:
55 ggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaataca-ctaaa 153  Q
    |||||||||||||||| ||||||  |||| |||  |||||||||||| |||||||||| ||||| ||||||||||||||  ||| ||||||||| | |||    
2435946 ggtaaagttgttgtcacgtgactgaaaggtcacgggttcaagtcctggaaacagcctcctgtgtgaaaaatagggtaagcctgcgtacaatacaccaaaa 2435847  T
154 tgatgggactccttcccggaccctgcgtatgcgggagctttagtg 198  Q
    || |||||| |||| ||| ||||| || |||||||||||||||||    
2435846 tggtgggacccctttccgtaccctccgcatgcgggagctttagtg 2435802  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #28
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 37 - 216
Target Start/End: Original strand, 19414420 - 19414597
Alignment:
37 ggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggtt 136  Q
    |||||||| |||  || |||||||||||||||||| |||||  |||| |||  |||||||||||  ||| |||||||| ||||||| |  || ||||| |    
19414420 ggtaaccttggcgtaattggtaaagttgttgtcatatgactgaaaggtcacgggttcaagtcctagaaagagcctcttatgtaaaaca--ggttaaggct 19414517  T
137 gcctacaatacactaaatgatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgccctttta 216  Q
    || |||||||||| ||||| |||||| |||||||| ||||||| |||||||||||| ||||| |||  ||||||||||||    
19414518 gcgtacaatacaccaaatggtgggaccccttcccgtaccctgcatatgcgggagctctagtgcaccgggttgccctttta 19414597  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #29
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 56 - 203
Target Start/End: Original strand, 19701570 - 19701718
Alignment:
56 gtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacactaaa-t 154  Q
    |||||||||||||| |||||||  || | |||  ||| ||||| |||||||||||||||||||||||||   ||||||| ||  |||||||||| ||| |    
19701570 gtaaagttgttgtcgtgtgactgaaatgtcacgggtttaagtcatgaaaacagcctcttgtgtaaaaaacttggtaaggatgggtacaatacaccaaaat 19701669  T
155 gatgggactccttcccggaccctgcgtatgcgggagctttagtgtacca 203  Q
    | |||| | ||||||||||||||||||||||||||||||||||| ||||    
19701670 ggtggggccccttcccggaccctgcgtatgcgggagctttagtgcacca 19701718  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #30
Raw Score: 59; E-Value: 7e-25
Query Start/End: Original strand, 58 - 216
Target Start/End: Original strand, 9939463 - 9939624
Alignment:
58 aaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacac--taaatg 155  Q
    ||||||||||||||||||||  |||| |||  |||||||||||| ||||| |||||||| ||| ||| | ||||||||||| | ||||||||   |||||    
9939463 aaagttgttgtcatgtgactgaaaggtcacgagttcaagtcctggaaacaacctcttgtttaagaaacatggtaaggttgcgtgcaatacaccaaaaatg 9939562  T
156 atggga-ctccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgccctttta 216  Q
     ||||| | ||||| ||||||||||||||||||||||||||||| |||  ||| ||||||||    
9939563 gtgggacccccttctcggaccctgcgtatgcgggagctttagtgcaccgggttaccctttta 9939624  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #31
Raw Score: 59; E-Value: 7e-25
Query Start/End: Original strand, 97 - 215
Target Start/End: Complemental strand, 31382330 - 31382213
Alignment:
97 tcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacactaaatgatgggactccttcccggaccctgcgtatgcgggagctttag 196  Q
    ||||| |||||||||||||||||||||  ||| ||||| ||| |||||||||| ||||| |||||| |||||| ||||||||| |||||||||||||||     
31382330 tcctggaaacagcctcttgtgtaaaaac-aggataaggctgcgtacaatacaccaaatggtgggaccccttcctggaccctgcatatgcgggagctttac 31382232  T
197 tgtaccatgttgccctttt 215  Q
    ||||||  |||||||||||    
31382231 tgtaccgggttgccctttt 31382213  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #32
Raw Score: 59; E-Value: 7e-25
Query Start/End: Original strand, 90 - 215
Target Start/End: Complemental strand, 35253309 - 35253186
Alignment:
90 gttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacactaaatgatgggactccttcccggaccctgcgtatgcggga 189  Q
    |||||||||||  |||||||||||||||||||| |  |||||||| ||| |||||||||| ||||| |||||| |||||||||||||||| |||||||||    
35253309 gttcaagtcctcgaaacagcctcttgtgtaaaaca--gggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcggga 35253212  T
190 gctttagtgtaccatgttgccctttt 215  Q
    ||| ||||| |||   ||||||||||    
35253211 gctctagtgcaccggattgccctttt 35253186  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #33
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 39 - 215
Target Start/End: Complemental strand, 12127010 - 12126836
Alignment:
39 taacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgc 138  Q
    |||||| ||| ||||| |||||||||||||||||| | |  |||| |||  ||| |||| ||| ||||||| |||||||||||| |  |||||||| |||    
12127010 taaccttggcgcaactcgtaaagttgttgtcatgtaattgaaaggtcacgggtttaagttctggaaacagcttcttgtgtaaaaca--gggtaaggctgc 12126913  T
139 ctacaatacactaaatgatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgccctttt 215  Q
     |||||||||| ||||  |||||| |||||||||||||||| |||||||||||| ||||| ||   |||||||||||    
12126912 gtacaatacaccaaattgtgggaccccttcccggaccctgcatatgcgggagctgtagtgcactgcgttgccctttt 12126836  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #34
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 32 - 217
Target Start/End: Complemental strand, 19932934 - 19932750
Alignment:
32 tgaggggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggta 131  Q
    |||||||| |||| ||| ||||||||||||||||||||||||||||  |||| ||   ||||||||  || | ||| ||| |||||||||||| ||||||    
19932934 tgaggggttaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcatgggttcaagt--tggatacaacct-ttgtgtaaaaaacagggta 19932838  T
132 aggttgcctacaatacactaaa--tgatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgcccttttat 217  Q
    ||| ||| |||||||||| |||  || |||||| ||||||||||||||||||||||  || | |||||| |||| |||||||| ||||    
19932837 aggctgcgtacaatacaccaaaaatggtgggaccccttcccggaccctgcgtatgcaagatcattagtgcaccaggttgccctattat 19932750  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #35
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 54 - 190
Target Start/End: Original strand, 20036218 - 20036355
Alignment:
54 tggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaa-aaatagggtaaggttgcctacaatacactaa 152  Q
    ||||||||||||||||||||||||  |||| |||  |||||||||||| |||||  |||||||||||| | | |||||||| |||| | |||||||| ||    
20036218 tggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacaaactcttgtgtaaagagaaagggtaagattgcgttcaatacaccaa 20036317  T
153 atgatgggactccttcccggaccctgcgtatgcgggag 190  Q
    ||| ||| || |||||||||||||||||||||| ||||    
20036318 atggtggaaccccttcccggaccctgcgtatgcaggag 20036355  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #36
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 37 - 197
Target Start/End: Complemental strand, 18335465 - 18335305
Alignment:
37 ggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggtt 136  Q
    |||||||| ||| ||| || ||||||| |||||||||| ||  |||| |||| ||| |||||||| |||||| ||||||| |||||| |||||||| |||    
18335465 ggtaaccttggcgcaagtgataaagtttttgtcatgtgtctgaaaggtcacaagttaaagtcctggaaacagtctcttgtttaaaaattagggtaaagtt 18335366  T
137 gcctacaatacactaaatgatgggactccttcccggaccctgcgtatgcgggagctttagt 197  Q
    || |||||||||  |||||||||||| | ||||  |||| || |||| |||||||||||||    
18335365 gcgtacaatacatcaaatgatgggaccctttcctagaccatgtgtatacgggagctttagt 18335305  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #37
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 55 - 194
Target Start/End: Original strand, 11596512 - 11596650
Alignment:
55 ggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacactaaat 154  Q
    |||||||| | ||||||||||||  || | |||  |||||||||||  ||||| |||||||||||||||  ||||||||| ||| || ||||||| ||||    
11596512 ggtaaagtggctgtcatgtgactgaaatgtcacgggttcaagtcctagaaacaacctcttgtgtaaaaac-agggtaaggctgcgtataatacaccaaat 11596610  T
155 gatgggactccttcccggaccctgcgtatgcgggagcttt 194  Q
    | |||||| |||||| ||||||||||||||||||||||||    
11596611 ggtgggaccccttcctggaccctgcgtatgcgggagcttt 11596650  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #38
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 54 - 198
Target Start/End: Complemental strand, 15511311 - 15511164
Alignment:
54 tggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgc--ctacaataca-ct 150  Q
    ||||||||||||||| ||||| ||  |||| ||||| || |||||||| |||| ||||||||||||||||| ||||||||| |||   ||||||||| |     
15511311 tggtaaagttgttgtaatgtggctgaaaggtcacatattgaagtcctggaaaccgcctcttgtgtaaaaaacagggtaaggctgcggatacaatacacca 15511212  T
151 aaatgatgggactccttcccggaccctgcgtatgcgggagctttagtg 198  Q
    ||||| ||| || |||||| |||||||||||||| | |||||||||||    
15511211 aaatggtggtaccccttcctggaccctgcgtatgtgtgagctttagtg 15511164  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #39
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 53 - 160
Target Start/End: Complemental strand, 4430187 - 4430080
Alignment:
53 ctggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacactaa 152  Q
    ||||||||||||||||||||||||| ||||| |||  ||| ||||| |||||||||  |||||||||||||| ||||||||  ||| |||||||||| ||    
4430187 ctggtaaagttgttgtcatgtgactggaaggtcacgggtttaagtcttgaaaacagtatcttgtgtaaaaaacagggtaagactgcgtacaatacaccaa 4430088  T
153 atgatggg 160  Q
    ||| ||||    
4430087 atggtggg 4430080  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #40
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 38 - 215
Target Start/End: Complemental strand, 18742137 - 18741956
Alignment:
38 gtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctga-aaacagcctcttgtgtaaaaaat-agggtaaggt 135  Q
    ||||||| ||| ||||||||||||||||||||||||||||  |||| ||   |||||| || ||  |||||| || |||| |||||||  |||||||||     
18742137 gtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcaagggttcaaatcttgggaaacagtcttttgtataaaaaaacagggtaaggc 18742038  T
136 tgcctacaatacactaaa--tgatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgccctttt 215  Q
    ||| |||||||||| |||  || |||||| ||||||| ||||||||||||||| ||||||||||| |||  ||| |||||||    
18742037 tgcgtacaatacaccaaaaatggtgggaccccttcccagaccctgcgtatgcgagagctttagtgcaccgggtttccctttt 18741956  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #41
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 56 - 194
Target Start/End: Complemental strand, 44485267 - 44485129
Alignment:
56 gtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacactaaatg 155  Q
    |||||||||||||||||||| |  |||| |||  |||  ||||||| ||||| || ||||||||||| | | ||||||| ||| |||||||||| |||||    
44485267 gtaaagttgttgtcatgtgattgaaaggtcacgggttatagtcctggaaacaaccacttgtgtaaaagacatggtaaggctgcgtacaatacaccaaatg 44485168  T
156 atgggactccttcccggaccctgcgtatgcgggagcttt 194  Q
     | |||| |||||||||| ||| ||||||||||||||||    
44485167 gttggaccccttcccggatcctacgtatgcgggagcttt 44485129  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #42
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 98 - 215
Target Start/End: Original strand, 23796507 - 23796624
Alignment:
98 cctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacactaaatgatgggactccttcccggaccctgcgtatgcgggagctttagt 197  Q
    |||| |||||||||||||||||||||  |  |||||||||| |||||||||| ||||| || ||| ||||||| |||||||| ||||| |||||||||||    
23796507 cctggaaacagcctcttgtgtaaaaatcaatgtaaggttgcgtacaatacaccaaatggtgagaccccttcccagaccctgcatatgctggagctttagt 23796606  T
198 gtaccatgttgccctttt 215  Q
    | |||  | |||||||||    
23796607 gcaccgggctgccctttt 23796624  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #43
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 36 - 134
Target Start/End: Original strand, 25290143 - 25290243
Alignment:
36 gggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctg--aaaacagcctcttgtgtaaaaaatagggtaag 133  Q
    ||||||||| ||| |||| |||||||||||||||||||||||  |||| ||| |||||||||| ||  || |||||||||||||||||||| ||||||||    
25290143 gggtaaccttggcgcaacaggtaaagttgttgtcatgtgactgaaaggtcacgtgttcaagtcttggaaacacagcctcttgtgtaaaaaacagggtaag 25290242  T
134 g 134  Q
    |    
25290243 g 25290243  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #44
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 96 - 199
Target Start/End: Complemental strand, 20169207 - 20169104
Alignment:
96 gtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacactaaatgatgggactccttcccggaccctgcgtatgcgggagcttta 195  Q
    |||||||||||| |||||||||||||||| | ||||||  ||  |||||||| | ||  | ||||||||||||||||||||||| ||||||||||||||     
20169207 gtcctgaaaacaccctcttgtgtaaaaaaaaaggtaagactgtgtacaataccccaatcggtgggactccttcccggaccctgcatatgcgggagctttt 20169108  T
196 gtgt 199  Q
    ||||    
20169107 gtgt 20169104  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #45
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 46 - 192
Target Start/End: Complemental strand, 27136819 - 27136673
Alignment:
46 ggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaat 145  Q
    |||||||| |||||||||||||||| |||| | ||||| |||  |||||||| |||  |||| |||||||||||||||| | ||||||||||| ||||||    
27136819 ggcacaac-ggtaaagttgttgtcacgtgattggaaggacacgagttcaagttctgggaacaacctcttgtgtaaaaaacatggtaaggttgcgtacaat 27136721  T
146 aca-ctaaatgatgggactccttcccggaccctgcgtatgcgggagct 192  Q
    ||| | ||||| |||||| ||||||  || | || |||||||||||||    
27136720 acaccaaaatggtgggaccccttcctagatcatgtgtatgcgggagct 27136673  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #46
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 55 - 198
Target Start/End: Original strand, 35019229 - 35019371
Alignment:
55 ggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacactaaat 154  Q
    ||||||||||||||||  |||||  |||| ||||  ||||||||||| ||||| |||||||| ||||||  ||  ||||| ||| |||||||||| || |    
35019229 ggtaaagttgttgtcacatgactgaaaggtcacagattcaagtcctgtaaacaacctcttgtataaaaatcagtataaggctgcatacaatacaccaatt 35019328  T
155 gatgggactccttcccggaccctgcgtatgcgggagctttagtg 198  Q
    | |||||| || |||| ||||||||||||||| |||||||||||    
35019329 ggtgggac-ccctcccagaccctgcgtatgcgagagctttagtg 35019371  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #47
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 80 - 198
Target Start/End: Complemental strand, 45264534 - 45264415
Alignment:
80 aaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaataca-ctaaatgatgggactccttcccggaccctg 178  Q
    |||| ||||||||||||||||| ||||| ||||||||| |||||| || |||||| ||  | ||||||| | ||||| |||||| ||||| | |||||||    
45264534 aaggtcacatgttcaagtcctggaaacaacctcttgtgcaaaaaacagagtaaggctgtgtgcaatacaccaaaatggtgggaccccttctcagaccctg 45264435  T
179 cgtatgcgggagctttagtg 198  Q
    | ||||||||||||||||||    
45264434 catatgcgggagctttagtg 45264415  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #48
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 50 - 144
Target Start/End: Complemental strand, 14988083 - 14987989
Alignment:
50 caactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaa 144  Q
    |||||||||||||||||||||| ||||||||| | |||| |||||||||||||||||||  |||| ||||||| | ||| ||||| ||| |||||    
14988083 caactggtaaagttgttgtcatatgactagaaagtcacaagttcaagtcctgaaaacagtatcttatgtaaaatacaggataaggctgcgtacaa 14987989  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #49
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 34 - 120
Target Start/End: Original strand, 21723642 - 21723727
Alignment:
34 aggggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaa 120  Q
    |||||||||||  ||||||||||||||||||||||||||||||| || ||  ||| |||| ||||||| ||||||||||||||||||    
21723642 aggggtaaccttcgcacaactggtaaagttgttgtcatgtgactggatggttacaagttc-agtcctggaaacagcctcttgtgtaa 21723727  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #50
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 120 - 215
Target Start/End: Complemental strand, 42304303 - 42304206
Alignment:
120 aaaaatagggtaaggttgcctacaatacactaaa--tgatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgccctttt 215  Q
    ||||| ||||||||||||| |||||||||| |||  || |||||| ||||||||||||||||||||| ||||||||||||| |||   ||||||||||    
42304303 aaaaacagggtaaggttgcgtacaatacacaaaaaatggtgggaccccttcccggaccctgcgtatgtgggagctttagtgcaccggattgccctttt 42304206  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #51
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 55 - 195
Target Start/End: Original strand, 50811938 - 50812079
Alignment:
55 ggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaat-agggtaaggttgcctacaatacactaaa 153  Q
    |||||||||||||||| ||||||  |||| |||    ||| |||||| ||||||| ||||||||||||||  ||||||||||||| |||||||||| |||    
50811938 ggtaaagttgttgtcacgtgactgaaaggtcacggaatcatgtcctggaaacagcttcttgtgtaaaaaaacagggtaaggttgcgtacaatacaccaaa 50812037  T
154 -tgatgggactccttcccggaccctgcgtatgcgggagcttta 195  Q
     || ||| || ||||||||  ||||||||||||||||||||||    
50812038 atggtgg-accccttcccgcgccctgcgtatgcgggagcttta 50812079  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #52
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 90 - 198
Target Start/End: Complemental strand, 19974198 - 19974090
Alignment:
90 gttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacactaaa-tgatgggactccttcccggaccctgcgtatgcggg 188  Q
    ||||||||| || ||||||||||  ||||||||| ||||| |||||||| |||||||||| ||| ||||||||| | ||||||||| ||  |||||||||    
19974198 gttcaagtcttggaaacagcctcaagtgtaaaaa-tagggcaaggttgcgtacaatacaccaaaatgatgggacccattcccggactctatgtatgcggg 19974100  T
189 agctttagtg 198  Q
    ||||||||||    
19974099 agctttagtg 19974090  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #53
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 107 - 216
Target Start/End: Complemental strand, 20999957 - 20999848
Alignment:
107 agcctcttgtgtaaaaaatagggtaaggttgcctacaatacactaaatgatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgt 206  Q
    |||| ||||||||||||| | || |||| ||| |||||||||| |||||||||| | |||||| | |||||||||| ||||||||||||||| |||  |     
20999957 agccacttgtgtaaaaaacaaggcaaggctgcgtacaatacaccaaatgatggggccccttccggcaccctgcgtacgcgggagctttagtgcaccgggc 20999858  T
207 tgccctttta 216  Q
    ||||||||||    
20999857 tgccctttta 20999848  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #54
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 98 - 191
Target Start/End: Complemental strand, 34149076 - 34148983
Alignment:
98 cctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacactaaatgatgggactccttcccggaccctgcgtatgcgggagc 191  Q
    |||| ||||||||||||||||| |||||||||||||||||| ||||| | || ||||| || ||| |||||| ||||||||| ||||| |||||    
34149076 cctggaaacagcctcttgtgtagaaaatagggtaaggttgcgtacaaaagaccaaatggtgagaccccttcctggaccctgcatatgcaggagc 34148983  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #55
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 56 - 198
Target Start/End: Complemental strand, 39215117 - 39214974
Alignment:
56 gtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaata-cactaaat 154  Q
    |||||||| |||||| ||||||| |||| | || |||||||| ||| ||||| ||||||||||||||||  |||||||| ||| |||||||   | ||||    
39215117 gtaaagttattgtcacgtgactaaaaggtcccaagttcaagtactggaaacaacctcttgtgtaaaaaactgggtaaggctgcgtacaatattccaaaat 39215018  T
155 gatgggactccttcccggaccctgcgtatgcgggagctttagtg 198  Q
    | |||| | |||||||  |||||||||||| || ||||||||||    
39215017 ggtgggtccccttcccaaaccctgcgtatgtggaagctttagtg 39214974  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #56
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 55 - 149
Target Start/End: Complemental strand, 17470505 - 17470411
Alignment:
55 ggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacac 149  Q
    |||||||||||||||| ||||||  | || ||   |||||||||||  |||||||||||||||||||||| ||||||||| ||| ||||||||||    
17470505 ggtaaagttgttgtcacgtgactgaatggtcatgggttcaagtcctagaaacagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacac 17470411  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #57
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 55 - 149
Target Start/End: Complemental strand, 50760385 - 50760291
Alignment:
55 ggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacac 149  Q
    |||||||| ||||||||||||||   ||| |||  |||||||||||||||||||||||||||||| ||||  |||||||| ||| || |||||||    
50760385 ggtaaagtagttgtcatgtgactgagaggtcacgggttcaagtcctgaaaacagcctcttgtgtataaaactgggtaaggctgcgtataatacac 50760291  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #58
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 33 - 162
Target Start/End: Original strand, 10163736 - 10163865
Alignment:
33 gaggggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaa 132  Q
    |||||||||| | ||| |||||| |||||||||||||||||| ||| || |  ||| ||| |||| ||||||||| |||||| ||||||||||| | |||    
10163736 gaggggtaacattggcgcaactgataaagttgttgtcatgtggctaaaatgttacaagtttaagttctgaaaacaacctcttatgtaaaaaatatgataa 10163835  T
133 ggttgcctacaatacactaaatgatgggac 162  Q
    | |||  |||||||||  ||||| ||||||    
10163836 gattgtatacaatacatcaaatggtgggac 10163865  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #59
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 121 - 198
Target Start/End: Complemental strand, 10378828 - 10378751
Alignment:
121 aaaatagggtaaggttgcctacaatacactaaatgatgggactccttcccggaccctgcgtatgcgggagctttagtg 198  Q
    |||| ||||||||| ||| |||||||||| ||||| |||||| |||||  ||||||||| ||||||||||||||||||    
10378828 aaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcttggaccctgcatatgcgggagctttagtg 10378751  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #60
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 90 - 212
Target Start/End: Original strand, 22324927 - 22325049
Alignment:
90 gttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacac--taaatgatgggactccttcccggaccctgcgtatgcgg 187  Q
    ||||||||| || |||||||||||||||| ||||| ||||||||| ||| ||||||||||   ||||| |||  | || |||| ||||||||||||||||    
22324927 gttcaagtcttggaaacagcctcttgtgt-aaaaacagggtaaggctgcatacaatacaccaaaaatggtggagccccgtccc-gaccctgcgtatgcgg 22325024  T
188 gagctttagtgtaccatgttgccct 212  Q
    ||||||||||| |||| | ||||||    
22325025 gagctttagtgcaccaggctgccct 22325049  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #61
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 54 - 119
Target Start/End: Complemental strand, 25554882 - 25554817
Alignment:
54 tggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgta 119  Q
    ||||||||||||||||| ||||||| |||||||| |||| |||||||| ||||| |||||||||||    
25554882 tggtaaagttgttgtcacgtgactaaaaggccacgtgtttaagtcctggaaacaacctcttgtgta 25554817  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #62
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 35 - 100
Target Start/End: Original strand, 40424721 - 40424786
Alignment:
35 ggggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcct 100  Q
    |||||||||| ||| ||||||||||||||||||||||||||||  ||||||||  |||||||||||    
40424721 ggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggccacgggttcaagtcct 40424786  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #63
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 126 - 195
Target Start/End: Original strand, 43768209 - 43768278
Alignment:
126 agggtaaggttgcctacaatacactaaatgatgggactccttcccggaccctgcgtatgcgggagcttta 195  Q
    ||||||||| |||||||||||||| || || |||||| ||||||| |||||||||||| |||||||||||    
43768209 agggtaaggctgcctacaatacaccaattggtgggaccccttcccagaccctgcgtatacgggagcttta 43768278  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #64
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 108 - 215
Target Start/End: Complemental strand, 1517418 - 1517310
Alignment:
108 gcctcttgtgt-aaaaaatagggtaaggttgcctacaatacactaaatgatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgt 206  Q
    ||||||||||| |||||| | | ||||| ||| |||||||||| || || |||||| ||||| | |||||||||||||| |||||||||||| |||  ||    
1517418 gcctcttgtgttaaaaaacatgataaggctgcgtacaatacaccaattggtgggaccccttctcagaccctgcgtatgcaggagctttagtgcaccgggt 1517319  T
207 tgccctttt 215  Q
    |||||||||    
1517318 tgccctttt 1517310  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #65
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 126 - 194
Target Start/End: Original strand, 15505634 - 15505702
Alignment:
126 agggtaaggttgcctacaatacactaaatgatgggactccttcccggaccctgcgtatgcgggagcttt 194  Q
    ||||||||  ||| |||||||||| ||||| |||||| |||||||| ||||||||||||||||||||||    
15505634 agggtaagactgcgtacaatacaccaaatggtgggaccccttcccgaaccctgcgtatgcgggagcttt 15505702  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #66
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 58 - 134
Target Start/End: Original strand, 22327101 - 22327177
Alignment:
58 aaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaagg 134  Q
    ||||||||||||||||||||  |||| | |  |||||||||||| ||||| |||||||||||||||| |||||||||    
22327101 aaagttgttgtcatgtgactgaaaggtcgcgggttcaagtcctggaaacaacctcttgtgtaaaaaacagggtaagg 22327177  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #67
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 308 - 368
Target Start/End: Original strand, 26879693 - 26879753
Alignment:
308 aaataacttaaaagaccaatatgttacaaacatcaaacttaaaggacctctgatgtaattt 368  Q
    |||||||||||| ||||||| |||||||||| |||||||||||||||||||| | ||||||    
26879693 aaataacttaaatgaccaatctgttacaaacctcaaacttaaaggacctctggtataattt 26879753  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #68
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 90 - 194
Target Start/End: Original strand, 30682848 - 30682950
Alignment:
90 gttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacactaaatgatgggactccttcccggaccctgcgtatgcggga 189  Q
    |||||| ||||||||| |||||||||||||||||  ||| |||| |||  |||| ||||  ||||| |||||| |||||||||||| |||||||||||||    
30682848 gttcaaatcctgaaaatagcctcttgtgtaaaaacaagg-taagattgtgtaca-tacaacaaatggtgggaccccttcccggaccgtgcgtatgcggga 30682945  T
190 gcttt 194  Q
    |||||    
30682946 gcttt 30682950  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #69
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 151 - 215
Target Start/End: Original strand, 50606498 - 50606562
Alignment:
151 aaatgatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgccctttt 215  Q
    ||||| |||||| |||||||||||||||| |||||||||||||||||| |||  |||||||||||    
50606498 aaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgccctttt 50606562  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #70
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 120 - 191
Target Start/End: Complemental strand, 21910743 - 21910673
Alignment:
120 aaaaatagggtaaggttgcctacaatacactaaatgatgggactccttcccggaccctgcgtatgcgggagc 191  Q
    ||||||||||||||||||| |||||||||| ||||| |||||| |||||||| ||||| ||| |||||||||    
21910743 aaaaatagggtaaggttgcgtacaatacaccaaatggtgggaccccttcccgaaccctacgt-tgcgggagc 21910673  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #71
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 50 - 149
Target Start/End: Original strand, 33222978 - 33223076
Alignment:
50 caactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacac 149  Q
    |||| |||||||||||||||||||||||  |||| |||   || ||||| || |||||||||||||||| ||||| |||| |||||||| ||||||||||    
33222978 caaccggtaaagttgttgtcatgtgactgaaaggtcacggatttaagtcatggaaacagcctcttgtgt-aaaaacagggaaaggttgcgtacaatacac 33223076  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #72
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 308 - 354
Target Start/End: Complemental strand, 34173363 - 34173317
Alignment:
308 aaataacttaaaagaccaatatgttacaaacatcaaacttaaaggac 354  Q
    |||||||||||| ||||||| ||||||||||||||||||||||||||    
34173363 aaataacttaaaggaccaatctgttacaaacatcaaacttaaaggac 34173317  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #73
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 107 - 191
Target Start/End: Complemental strand, 20982858 - 20982773
Alignment:
107 agcctcttgtgtaaaaaa-tagggtaaggttgcctacaatacactaaatgatgggactccttcccggaccctgcgtatgcgggagc 191  Q
    |||| ||||||||||||| |||||||||| |||| |||||||||  |||| |||||   |||| ||||||||||||||||||||||    
20982858 agccacttgtgtaaaaaaatagggtaaggctgccaacaatacacctaatggtgggatctcttctcggaccctgcgtatgcgggagc 20982773  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #74
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 34 - 155
Target Start/End: Original strand, 24564322 - 24564443
Alignment:
34 aggggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaag 133  Q
    ||||||||||| ||| ||||  ||||||||| |||| ||||| |  |||| | ||  |||||||| || ||||| |||||||||||||||| ||||||||    
24564322 aggggtaaccttggcgcaaccagtaaagttgatgtcttgtgattgaaaggtcgcagattcaagtcttggaaacaacctcttgtgtaaaaaacagggtaag 24564421  T
134 gttgcctacaatacactaaatg 155  Q
    | ||| |||||| ||| |||||    
24564422 ggtgcgtacaattcaccaaatg 24564443  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #75
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 31 - 108
Target Start/End: Original strand, 34714598 - 34714675
Alignment:
31 ttgaggggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacag 108  Q
    |||||||||||||| ||| |||||||||||||||||||||||||| |  |||| |||  ||||||||| || ||||||    
34714598 ttgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgattgaaaggtcacgggttcaagtcatggaaacag 34714675  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #76
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 90 - 198
Target Start/End: Original strand, 23371158 - 23371264
Alignment:
90 gttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacactaaatgatgggactccttcccggaccctgcgtatgcggga 189  Q
    |||||||||||  |||||||| |||| ||||||||  ||| |||||||  |||||||||| ||||| |||||| |||| || ||||||||||||| || |    
23371158 gttcaagtcctagaaacagccacttgggtaaaaaa-cgggcaaggttgtgtacaatacaccaaatgctgggacccctt-ccagaccctgcgtatgtggta 23371255  T
190 gctttagtg 198  Q
    |||||||||    
23371256 gctttagtg 23371264  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #77
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 308 - 368
Target Start/End: Complemental strand, 33650443 - 33650383
Alignment:
308 aaataacttaaaagaccaatatgttacaaacatcaaacttaaaggacctctgatgtaattt 368  Q
    |||||||||||| ||||||| ||||| |||| |||||||||||||||| ||| ||||||||    
33650443 aaataacttaaaggaccaatctgttataaacctcaaacttaaaggacccctggtgtaattt 33650383  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #78
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 55 - 126
Target Start/End: Complemental strand, 2436052 - 2435981
Alignment:
55 ggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaata 126  Q
    |||||||||||||||| ||||||  |||| |||  |||||||||||| ||||| |||| |||||||||||||    
2436052 ggtaaagttgttgtcacgtgactgaaaggtcacgggttcaagtcctggaaacaacctcctgtgtaaaaaata 2435981  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #79
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 162 - 217
Target Start/End: Complemental strand, 19386628 - 19386573
Alignment:
162 ctccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgcccttttat 217  Q
    |||||||||||||||||| |||||||||||| ||||| |||| ||||| |||||||    
19386628 ctccttcccggaccctgcatatgcgggagctctagtgaaccaggttgctcttttat 19386573  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #80
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 90 - 194
Target Start/End: Complemental strand, 31442515 - 31442409
Alignment:
90 gttcaagtcctgaaaacagcctcttgtgtaaaaaat-agggtaaggttgcctacaatacactaaa-tgatgggactccttcccggaccctgcgtatgcgg 187  Q
    ||||||||| |  ||||||||| || |||||||||  ||||||||| ||| |||||||||| ||| || |||||| ||||||||||| ||| ||||| ||    
31442515 gttcaagtcttagaaacagccttttatgtaaaaaaacagggtaaggatgcgtacaatacaccaaaatggtgggaccccttcccggacactgtgtatgtgg 31442416  T
188 gagcttt 194  Q
    |||||||    
31442415 gagcttt 31442409  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #81
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 66 - 198
Target Start/End: Complemental strand, 31272522 - 31272397
Alignment:
66 tgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacactaaatgatgggactcc 165  Q
    ||||| ||||||  |||| |||| |||||||||||| ||||| |||||||||||||||  | ||||||| ||| ||||  |||  ||||| ||||         
31272522 tgtcacgtgactgaaaggtcacaggttcaagtcctggaaacaacctcttgtgtaaaaac-atggtaaggctgcgtacagcacatcaaatggtggg----- 31272429  T
166 ttcccggaccctgcgtatgcgggagctttagtg 198  Q
     | ||||||||||||||||||||||||||||||    
31272428 -ttccggaccctgcgtatgcgggagctttagtg 31272397  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #82
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 157 - 198
Target Start/End: Complemental strand, 33594188 - 33594147
Alignment:
157 tgggactccttcccggaccctgcgtatgcgggagctttagtg 198  Q
    |||||| ||||||| |||||||||||||||||||||||||||    
33594188 tgggaccccttcccagaccctgcgtatgcgggagctttagtg 33594147  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #83
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 311 - 368
Target Start/End: Original strand, 33650696 - 33650753
Alignment:
311 taacttaaaagaccaatatgttacaaacatcaaacttaaaggacctctgatgtaattt 368  Q
    ||||||||| || |||| |||||| ||| |||||||||||||||||| ||||||||||    
33650696 taacttaaaggatcaatctgttacgaacctcaaacttaaaggacctcggatgtaattt 33650753  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #84
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 55 - 124
Target Start/End: Original strand, 52910216 - 52910285
Alignment:
55 ggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaa 124  Q
    |||||||||||||||||||||||  |||| |||| |||||| || || ||||||||||||  ||||||||    
52910216 ggtaaagttgttgtcatgtgactgaaaggtcacaggttcaactcttggaaacagcctcttaggtaaaaaa 52910285  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #85
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 34 - 146
Target Start/End: Complemental strand, 18336026 - 18335914
Alignment:
34 aggggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaag 133  Q
    |||||||| || ||| ||| || ||||||||||| |||||| ||  |||| ||||||||||||| ||||||| |  || |||| |||| || ||||||||    
18336026 aggggtaatcttggcgcaagtgataaagttgttgccatgtgtctgaaaggtcacatgttcaagttctgaaaataatctattgtttaaagaacagggtaag 18335927  T
134 gttgcctacaata 146  Q
    | ||| |||||||    
18335926 gctgcgtacaata 18335914  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #86
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 150 - 198
Target Start/End: Original strand, 30555209 - 30555257
Alignment:
150 taaatgatgggactccttcccggaccctgcgtatgcgggagctttagtg 198  Q
    |||||| |||||| ||||| ||||||||||||||||| |||||||||||    
30555209 taaatggtgggaccccttcacggaccctgcgtatgcgagagctttagtg 30555257  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #87
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 308 - 368
Target Start/End: Original strand, 40892591 - 40892651
Alignment:
308 aaataacttaaaagaccaatatgttacaaacatcaaacttaaaggacctctgatgtaattt 368  Q
    |||||||||||| || ||||||||||||||| ||||||| |||||||| |  |||||||||    
40892591 aaataacttaaatgatcaatatgttacaaacctcaaactcaaaggaccacaaatgtaattt 40892651  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #88
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 151 - 198
Target Start/End: Complemental strand, 4587626 - 4587579
Alignment:
151 aaatgatgggactccttcccggaccctgcgtatgcgggagctttagtg 198  Q
    ||||| |||||| |||||||||||||||| ||||||||||||| ||||    
4587626 aaatggtgggaccccttcccggaccctgcctatgcgggagcttcagtg 4587579  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #89
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 308 - 367
Target Start/End: Complemental strand, 52913076 - 52913017
Alignment:
308 aaataacttaaaagaccaatatgttacaaacatcaaacttaaaggacctctgatgtaatt 367  Q
    |||||||||||| ||| ||| |||||||||| ||||||||||| |||| ||| |||||||    
52913076 aaataacttaaaggactaatctgttacaaacttcaaacttaaaagacccctggtgtaatt 52913017  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #90
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 308 - 354
Target Start/End: Original strand, 2633555 - 2633601
Alignment:
308 aaataacttaaaagaccaatatgttacaaacatcaaacttaaaggac 354  Q
    |||||||||||| ||||||| ||| |||||| |||||||||||||||    
2633555 aaataacttaaatgaccaatctgtcacaaacctcaaacttaaaggac 2633601  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #91
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 50 - 120
Target Start/End: Original strand, 22151498 - 22151568
Alignment:
50 caactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaa 120  Q
    |||||| ||||||||||||||| |||||  |||| || | |||||||| ||| |||||||||||| |||||    
22151498 caactgataaagttgttgtcatctgactgtaaggtcataggttcaagttctggaaacagcctcttatgtaa 22151568  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #92
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 55 - 133
Target Start/End: Complemental strand, 34679378 - 34679300
Alignment:
55 ggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaag 133  Q
    ||||||||| |||||||||||||  ||   ||||||||| | ||||  ||||| |||||||||||||||| ||||||||    
34679378 ggtaaagttattgtcatgtgactgaaatatcacatgttccattcctagaaacaacctcttgtgtaaaaaacagggtaag 34679300  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #93
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 103 - 184
Target Start/End: Original strand, 21723731 - 21723811
Alignment:
103 aaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacactaaatgatgggactccttcccggaccctgcgtatg 184  Q
    |||||||||||||| ||||| ||||||||||| ||  |||||||||| ||||| | | ||   |||||||||||||||||||    
21723731 aaacagcctcttgtataaaa-atagggtaaggctgagtacaatacaccaaatggtagaaccttttcccggaccctgcgtatg 21723811  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #94
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 159 - 215
Target Start/End: Original strand, 16120819 - 16120875
Alignment:
159 ggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgccctttt 215  Q
    |||| ||||||||| |||||| ||||||||||||||| || |||| | |||||||||    
16120819 ggaccccttcccggcccctgcatatgcgggagctttaatgcaccaggctgccctttt 16120875  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 101; Significance: 6e-50; HSPs: 91)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 101; E-Value: 6e-50
Query Start/End: Original strand, 31 - 198
Target Start/End: Complemental strand, 2541203 - 2541035
Alignment:
31 ttgaggggtaacctcggcacaactggtaaagttgttgtcatgtgactagaa-ggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaataggg 129  Q
    |||||||||||||| ||| |||||||||||||||||||||||||||| ||| || |||  |||||||||||| |||||||||||||||||||||| ||||    
2541203 ttgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactggaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacaggg 2541104  T
130 taaggttgcctacaatacactaaatgatgggactccttcccggaccctgcgtatgcgggagctttagtg 198  Q
    ||||| ||| ||| |||||| ||||| |||||| ||||||||| |||||||||||||||||||||||||    
2541103 taaggctgcgtactatacaccaaatggtgggaccccttcccggtccctgcgtatgcgggagctttagtg 2541035  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 99; E-Value: 1e-48
Query Start/End: Original strand, 30 - 215
Target Start/End: Original strand, 32758212 - 32758395
Alignment:
30 tttgaggggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaataggg 129  Q
    ||||||||||||||| ||| ||||||||||||||||||||||||||||  |||| |||| |||||||||||| ||||||||||||||||  |||| ||||    
32758212 tttgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacaggttcaagtcctggaaacagcctcttgtgt--aaaacaggg 32758309  T
130 taaggttgcctacaatacactaaatgatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgccctttt 215  Q
    ||||| ||  |||||||||| ||||| |||||| |||||||||||||||| |||||||||||| ||||| |||  |||||||||||    
32758310 taaggctgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctttt 32758395  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 32 - 215
Target Start/End: Original strand, 42805477 - 42805662
Alignment:
32 tgaggggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggta 131  Q
    ||||||||||||| |||  ||||||||||||||||||||||||||| ||||| |||  |||||||||||| |||||||||||||||||||||| ||||||    
42805477 tgaggggtaaccttggcgtaactggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggta 42805576  T
132 aggttgcctacaatacacta--aatgatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgccctttt 215  Q
    ||| ||  |||||||||| |  |||| |||||| ||||||||||||| || |||||||||||||||||| |||  |||||||||||    
42805577 aggctgtgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccgggttgccctttt 42805662  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 94; E-Value: 9e-46
Query Start/End: Original strand, 40 - 213
Target Start/End: Complemental strand, 11617762 - 11617589
Alignment:
40 aacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcc 139  Q
    ||||||||| ||||||||||||||||||||||||||||  |||| |||| |||||||||||| ||||| |||||||||||||||| ||||||||  |||     
11617762 aacctcggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacaggttcaagtcctggaaacaacctcttgtgtaaaaaacagggtaagactgcg 11617663  T
140 tacaatacactaaatgatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgccctt 213  Q
    |||||||||| ||||| |||||| |||||| ||||||||||||||| ||| |||||||| |||  |||||||||    
11617662 tacaatacaccaaatggtgggaccccttcctggaccctgcgtatgcaggacctttagtgcaccgggttgccctt 11617589  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 93; E-Value: 4e-45
Query Start/End: Original strand, 33 - 216
Target Start/End: Complemental strand, 21172188 - 21172007
Alignment:
33 gaggggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaa 132  Q
    |||||||||||| ||| |||||||||||||||||||||||| |||  |||| |||  |||||||||||| ||||||||||||||||  |||| |||||||    
21172188 gaggggtaaccttggcgcaactggtaaagttgttgtcatgtaactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgt--aaaacagggtaa 21172091  T
133 ggttgcctacaatacactaaatgatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgccctttta 216  Q
    || ||| |||||||||| ||||| |||||| |||||||||||||||| |||||||||||| ||||| |||  ||||||||||||    
21172090 ggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctttta 21172007  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 93; E-Value: 4e-45
Query Start/End: Original strand, 33 - 214
Target Start/End: Original strand, 47716413 - 47716596
Alignment:
33 gaggggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaa 132  Q
    |||||||||||| ||||||||||| |||||||||| ||||||||| ||||| |||  |||||||||||| |||||||||||||||||||||| |||||||    
47716413 gaggggtaaccttggcacaactggaaaagttgttgccatgtgactggaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaa 47716512  T
133 ggttgcctacaatacacta--aatgatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgcccttt 214  Q
    || ||| |||||||||| |  |||| |||||| ||||||||||||| || |||||||||||||| ||| |||  ||||||||||    
47716513 ggctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcgggagctttggtgcaccgggttgcccttt 47716596  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 91; E-Value: 6e-44
Query Start/End: Original strand, 33 - 215
Target Start/End: Original strand, 42798623 - 42798805
Alignment:
33 gaggggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaa 132  Q
    |||||||||||| ||| |||||||||||||||||||||||||||| ||||| |||  ||||||||| || |||||| ||||||||||||||| | |||||    
42798623 gaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcttggaaacagtctcttgtgtaaaaaacaaggtaa 42798722  T
133 ggttgcctacaatacactaaatgatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgccctttt 215  Q
    || ||| |||||||||| ||||| |||||| | |||||||||||||| |||||||||||| ||||| | |  |||||||||||    
42798723 ggctgcgtacaatacaccaaatggtgggaccctttcccggaccctgcatatgcgggagctatagtgcatcgggttgccctttt 42798805  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 86; E-Value: 6e-41
Query Start/End: Original strand, 32 - 197
Target Start/End: Complemental strand, 34626389 - 34626225
Alignment:
32 tgaggggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggta 131  Q
    |||||||||||||  || |||||||||||||||||||||||||| |  |||||||||  ||||||||||| |||||||||| ||||| ||||| ||||||    
34626389 tgaggggtaaccttagcgcaactggtaaagttgttgtcatgtgattgaaaggccacagattcaagtcctggaaacagcctcctgtgt-aaaaacagggta 34626291  T
132 aggttgcctacaatacactaaatgatgggactccttcccggaccctgcgtatgcgggagctttagt 197  Q
    ||| ||| | |||||||| ||||| |||||  ||||||||||||||||||||||||||||||||||    
34626290 aggctgcgttcaatacaccaaatggtgggatcccttcccggaccctgcgtatgcgggagctttagt 34626225  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #9
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 41 - 215
Target Start/End: Original strand, 27629596 - 27629770
Alignment:
41 acctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcct 140  Q
    |||| ||| |||||||||||||||||||||| ||||   |||| |||  |||||||||||| |||||||||||||||||||||| ||||||||||||| |    
27629596 accttggcgcaactggtaaagttgttgtcatttgaccgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaaggttgcgt 27629695  T
141 acaatacactaaatgatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgccctttt 215  Q
    | ||||||| ||||| |||||| ||||||||| |||||| ||||||| ||||| |||| |||  |||||||||||    
27629696 aaaatacaccaaatggtgggaccccttcccgggccctgcatatgcggtagcttcagtgcaccgggttgccctttt 27629770  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #10
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 50 - 215
Target Start/End: Complemental strand, 19427053 - 19426889
Alignment:
50 caactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacac 149  Q
    |||||||||||||||||||||||||||   |||| |||  |||||||||||| |||||||||||||||||||||||||||||||  ||| ||||||||||    
19427053 caactggtaaagttgttgtcatgtgaccgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaatagggtaagactgcgtacaatacac 19426954  T
150 taaatgatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgccctttt 215  Q
     ||||| |||||| ||||| |||||||||| |||||| |||||| |||| |||  |||||||||||    
19426953 caaatggtgggac-ccttctcggaccctgcatatgcgagagcttcagtgcaccgggttgccctttt 19426889  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #11
Raw Score: 81; E-Value: 5e-38
Query Start/End: Original strand, 32 - 214
Target Start/End: Complemental strand, 48735303 - 48735122
Alignment:
32 tgaggggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcct-gaaaacagcctcttgtgtaaaaaatagggt 130  Q
    ||||||||||||| ||| ||||||||||||||||||||||||||||  |||| |||  ||||||||||| | ||||| |||||||||||||| |   |||    
48735303 tgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtccttggaaacaacctcttgtgtaaaacac--ggt 48735206  T
131 aaggttgcctacaatacactaaatgatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgcccttt 214  Q
    |||| ||| |||||||||| ||||| |||||| |||||||||||||||| |||||||||||| ||||| |||  ||||||||||    
48735205 aaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgcccttt 48735122  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #12
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 40 - 198
Target Start/End: Complemental strand, 10693245 - 10693089
Alignment:
40 aacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcc 139  Q
    ||||| ||| ||||| ||||||||||||||||||||||  |||| |||  |||||||||||| ||||||||||||||||  |||| ||||||||| |||     
10693245 aaccttggcgcaactagtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgt--aaaagagggtaaggctgcg 10693148  T
140 tacaatacactaaatgatgggactccttcccggaccctgcgtatgcgggagctttagtg 198  Q
    |||||||||| ||||| |||||| |||||||||||||||| |||||||||||| |||||    
10693147 tacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtg 10693089  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #13
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 32 - 198
Target Start/End: Complemental strand, 35334996 - 35334832
Alignment:
32 tgaggggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggta 131  Q
    |||||| |||||| ||| |||||||||||||||||||||||||||| ||||| |||  |||||||||||| ||||||  ||| |||||||||| ||||||    
35334996 tgagggataaccttggcgcaactggtaaagttgttgtcatgtgactggaaggtcacgagttcaagtcctggaaacag--tctcgtgtaaaaaacagggta 35334899  T
132 aggttgcctacaatacactaaatgatgggactccttcccggaccctgcgtatgcgggagctttagtg 198  Q
    ||  ||  ||||||||||  |||| |||||| |||||||||||||||||||||| ||||||||||||    
35334898 agactgtgtacaatacaccgaatggtgggaccccttcccggaccctgcgtatgcaggagctttagtg 35334832  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #14
Raw Score: 79; E-Value: 8e-37
Query Start/End: Original strand, 33 - 215
Target Start/End: Original strand, 43557426 - 43557611
Alignment:
33 gaggggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaa 132  Q
    |||||||||||| | | ||||||||||||||||||||||||||||  |||| ||   |||||||||||| |||||||||||||||||||||| || ||||    
43557426 gaggggtaaccttgccgcaactggtaaagttgttgtcatgtgactgaaaggtcatgggttcaagtcctggaaacagcctcttgtgtaaaaaacagagtaa 43557525  T
133 ggttgcctacaatacacta--aatgatgggactccttcccggaccctgcgtatgcgggagc-tttagtgtaccatgttgccctttt 215  Q
    || ||| |||||||||| |  |||| |||||| || |||||||| |||||||||||||||| ||||||| |||  |||||||||||    
43557526 ggctgcgtacaatacaccaataatggtgggaccccctcccggactctgcgtatgcgggagcttttagtgcaccgggttgccctttt 43557611  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #15
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 34 - 198
Target Start/End: Complemental strand, 8149126 - 8148962
Alignment:
34 aggggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgt-aaaaaatagggtaa 132  Q
    ||||||||||| |||||||||||||| |||||||||||||||||  || | |||  |||||||||||||||||  |||||||||| ||||||||||||||    
8149126 aggggtaaccttggcacaactggtaatgttgttgtcatgtgactgcaaagtcacgagttcaagtcctgaaaactacctcttgtgttaaaaaatagggtaa 8149027  T
133 ggttgcctacaatacactaaatgatgggactccttcccggaccctgcgtatgcgggagctttagtg 198  Q
    |||||| |||||||||| ||||| |||||| ||||||| || | |||||||||| ||| |||||||    
8149026 ggttgcgtacaatacaccaaatggtgggaccccttcccaga-cttgcgtatgcgagagttttagtg 8148962  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #16
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 70 - 215
Target Start/End: Complemental strand, 38262340 - 38262195
Alignment:
70 atgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacactaaatgatgggactccttcc 169  Q
    |||||||| ||||| |||  |||||||||||| |||||| ||||||||||||||||| ||||| ||||| |||||||||| |||||||||||| ||||||    
38262340 atgtgactggaaggtcacgggttcaagtcctggaaacagtctcttgtgtaaaaaatatggtaatgttgcatacaatacaccaaatgatgggaccccttcc 38262241  T
170 cggaccctgcgtatgcgggagctttagtgtaccatgttgccctttt 215  Q
    || || ||||||||||||||||||||||| |||   ||||||||||    
38262240 cgaacactgcgtatgcgggagctttagtgcaccggattgccctttt 38262195  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #17
Raw Score: 76; E-Value: 5e-35
Query Start/End: Original strand, 33 - 185
Target Start/End: Original strand, 46354148 - 46354302
Alignment:
33 gaggggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaa 132  Q
    |||||||||||| ||| |||||||||||||||||||||||||| | ||||| |||  |||||||||||| ||||| |||||||||||||||| |||||||    
46354148 gaggggtaaccttggcgcaactggtaaagttgttgtcatgtgattggaaggtcacgggttcaagtcctggaaacaacctcttgtgtaaaaaacagggtaa 46354247  T
133 ggttgcctacaatacacta--aatgatgggactccttcccggaccctgcgtatgc 185  Q
    || ||| |||||||||| |  |||| |||||| ||||||||||||| || |||||    
46354248 ggctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgc 46354302  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #18
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 33 - 198
Target Start/End: Complemental strand, 47078034 - 47077871
Alignment:
33 gaggggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaa 132  Q
    |||||||||||| ||| ||||||||||||||||||||||||||||  |||| |||  |||||||||||| |||||| |||||||||  ||||||| ||||    
47078034 gaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagtctcttgtgt--aaaatagagtaa 47077937  T
133 ggttgcctacaatacactaaatgatgggactccttcccggaccctgcgtatgcgggagctttagtg 198  Q
     ||||| |||||||||| ||||| |||||| |||||||  ||||| | |||||||||||| |||||    
47077936 agttgcgtacaatacacaaaatggtgggaccccttcccaaaccctacatatgcgggagctctagtg 47077871  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #19
Raw Score: 74; E-Value: 8e-34
Query Start/End: Original strand, 39 - 216
Target Start/End: Original strand, 40463837 - 40464013
Alignment:
39 taacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgc 138  Q
    |||||| ||| |||| |||||||||||||||||||||||  |||| |||  ||||||||| |  |||||| |||||||||||||| | |||||||| |||    
40463837 taaccttggcgcaaccggtaaagttgttgtcatgtgactgtaaggtcacgggttcaagtcatagaaacagtctcttgtgtaaaaact-gggtaaggctgc 40463935  T
139 ctacaatacactaaatgatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgccctttta 216  Q
     || ||||||| ||||| |||||| ||||| |||||||||||||||||||||||| |||| |||  ||||||||||||    
40463936 gtataatacaccaaatggtgggaccccttctcggaccctgcgtatgcgggagcttcagtgcaccgagttgccctttta 40464013  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #20
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 55 - 198
Target Start/End: Complemental strand, 23419833 - 23419690
Alignment:
55 ggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacactaaat 154  Q
    |||||||||| ||||||||||||| |||| |||| |||||||| ||| |||||||||||||||||||||| ||||||||  ||| |||||||||| ||||    
23419833 ggtaaagttgctgtcatgtgactaaaaggtcacaggttcaagttctggaaacagcctcttgtgtaaaaaacagggtaagactgcgtacaatacaccaaat 23419734  T
155 gatgggactccttcccggaccctgcgtatgcgggagctttagtg 198  Q
    | |||||| ||||||  |||| ||||| |||||| |||||||||    
23419733 ggtgggaccccttcctagaccttgcgtgtgcgggggctttagtg 23419690  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #21
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 61 - 215
Target Start/End: Complemental strand, 42391251 - 42391099
Alignment:
61 gttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacactaaatgatggg 160  Q
    |||||||||||||||||  |||| |||  |||||||||||| ||||||| |||||||||||| |  |||||||| ||| |||||||||| ||||| ||||    
42391251 gttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcttcttgtgtaaaaca--gggtaaggctgcgtacaatacaccaaatggtggg 42391154  T
161 actccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgccctttt 215  Q
    || |||||||||||||||| |||||||||||| ||||| |||  |||||||||||    
42391153 accccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctttt 42391099  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #22
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 90 - 215
Target Start/End: Original strand, 7879649 - 7879774
Alignment:
90 gttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacactaaatgatgggactccttcccggaccctgcgtatgcggga 189  Q
    |||||||||||| |||||  ||||||||||||||| | ||||||| ||| |||||||||| ||||| |||||| ||||||||||||||||||||||||||    
7879649 gttcaagtcctggaaacaatctcttgtgtaaaaaacaaggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgcggga 7879748  T
190 gctttagtgtaccatgttgccctttt 215  Q
    |||| |||| |||  |||||||||||    
7879749 gcttcagtgcaccgggttgccctttt 7879774  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #23
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 53 - 210
Target Start/End: Complemental strand, 33872070 - 33871914
Alignment:
53 ctggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacactaa 152  Q
    |||||||||||||||||||||||||  |||| | |  |||||||||||| ||||| |||||||||||||||  ||| ||||| ||| |||||||||| ||    
33872070 ctggtaaagttgttgtcatgtgactgaaaggtcgcgggttcaagtcctggaaacaacctcttgtgtaaaaac-aggataaggctgcgtacaatacaccaa 33871972  T
153 atgatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgcc 210  Q
    ||| |||||| ||||||| ||||||| ||||||| ||||||||||| |||| ||||||    
33871971 atggtgggaccccttcccagaccctgtgtatgcgagagctttagtgcaccaggttgcc 33871914  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #24
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 55 - 193
Target Start/End: Original strand, 19266426 - 19266564
Alignment:
55 ggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacactaaat 154  Q
    |||||||||||||||||||||||  |||| |    |||||||||||||||| |||| |||| |||||||| ||||||||| ||| |||||||||| ||||    
19266426 ggtaaagttgttgtcatgtgactgaaaggtcgtgggttcaagtcctgaaaatagccacttgcgtaaaaaacagggtaaggctgcgtacaatacaccaaat 19266525  T
155 gatgggactccttcccggaccctgcgtatgcgggagctt 193  Q
      |||||  ||||||||||||||||||||||||||||||    
19266526 tgtgggatcccttcccggaccctgcgtatgcgggagctt 19266564  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #25
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 32 - 213
Target Start/End: Original strand, 42476826 - 42477005
Alignment:
32 tgaggggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggta 131  Q
    ||||||||||| | |||  |||||||||||||||||||||||||||| |||| |||   ||||||| ||| |||||| |||||||||  |||| | ||||    
42476826 tgaggggtaacattggcgtaactggtaaagttgttgtcatgtgactaaaaggtcacggattcaagttctggaaacagtctcttgtgt--aaaacaaggta 42476923  T
132 aggttgcctacaatacactaaatgatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgccctt 213  Q
    ||| ||| |||||||||| ||||| |||||| ||||||  | | |||| |||||||||||| ||||| |||| |||||||||    
42476924 aggctgcgtacaatacaccaaatggtgggaccccttcctaggctctgcatatgcgggagctctagtgcaccaggttgccctt 42477005  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #26
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 33 - 192
Target Start/End: Complemental strand, 2663112 - 2662958
Alignment:
33 gaggggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaa 132  Q
    |||||||||||| ||| ||||| ||||||||||||| |||||||| ||  | || | |||||||||||| ||||||||||||||||  ||||||||||||    
2663112 gaggggtaaccttggcgcaactagtaaagttgttgttatgtgactgga--gtcataggttcaagtcctggaaacagcctcttgtgt--aaaatagggtaa 2663017  T
133 ggttgcctacaatacactaaatgatgggactccttcccggaccctgcgtatgcgggagct 192  Q
    || ||| |||||||||| ||||| |||||| ||||  | |||||||| ||||||||||||    
2663016 ggctgcgtacaatacaccaaatggtgggac-ccttttcagaccctgcatatgcgggagct 2662958  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #27
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 90 - 219
Target Start/End: Complemental strand, 18512576 - 18512448
Alignment:
90 gttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacactaaatgatgggactccttcccggaccctgcgtatgcggga 189  Q
    |||||||||||| ||||| | ||||||||||||| |||||||||| ||| ||||||||||  |||| |||||| ||||||||||||||||||||||||||    
18512576 gttcaagtcctggaaacaacatcttgtgtaaaaa-tagggtaaggctgcgtacaatacaccgaatggtgggaccccttcccggaccctgcgtatgcggga 18512478  T
190 gctttagtgtaccatgttgcccttttattt 219  Q
    ||||| ||| ||   |||||||| ||||||    
18512477 gctttggtgcactgggttgccctgttattt 18512448  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #28
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 55 - 194
Target Start/End: Complemental strand, 28362304 - 28362165
Alignment:
55 ggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacactaaat 154  Q
    |||||||||||||||||||| ||  |||| |||| |||||||||||  |||| |||||||||||||||||   ||||||| ||| |||||||||| ||||    
28362304 ggtaaagttgttgtcatgtggctgaaaggtcacaggttcaagtcctagaaactgcctcttgtgtaaaaaacttggtaaggctgcgtacaatacaccaaat 28362205  T
155 gatgggactccttcccggaccctgcgtatgcgggagcttt 194  Q
    | |||||| ||||||| |||| ||| |||| |||||||||    
28362204 ggtgggaccccttcccagaccttgcatatgtgggagcttt 28362165  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #29
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 55 - 213
Target Start/End: Original strand, 29907393 - 29907552
Alignment:
55 ggtaaagttgttgt--catgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaataca-cta 151  Q
    ||||||||||||||  |||||||||  |||| |||  |||||||||||  ||||||||||||||||||||||||| |||||| ||| | ||||||| | |    
29907393 ggtaaagttgttgtatcatgtgactgaaaggtcacgggttcaagtcctagaaacagcctcttgtgtaaaaaatagtgtaaggctgcgttcaatacaccaa 29907492  T
152 aatgatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgccctt 213  Q
    |||| |||||| || |||||||||||  ||||||||||||||||||| |||  |||||||||    
29907493 aatggtgggaccccatcccggaccct--gtatgcgggagctttagtgcaccgggttgccctt 29907552  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #30
Raw Score: 59; E-Value: 7e-25
Query Start/End: Original strand, 90 - 219
Target Start/End: Complemental strand, 31591231 - 31591104
Alignment:
90 gttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacactaaatgatgggactccttcccggaccctgcgtatgcggga 189  Q
    |||||||||||| ||||| |||||||||||||| | ||  ||||| ||| ||||||||| |||||| |||||| |||||||||||| ||| |||||||||    
31591231 gttcaagtcctggaaacaacctcttgtgtaaaacagag--taaggctgcgtacaatacaataaatggtgggaccccttcccggaccttgcatatgcggga 31591134  T
190 gctttagtgtaccatgttgcccttttattt 219  Q
    ||| ||||| |||  |||||||||||||||    
31591133 gctctagtgcaccgggttgcccttttattt 31591104  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #31
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 34 - 123
Target Start/End: Original strand, 18326989 - 18327078
Alignment:
34 aggggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaa 123  Q
    ||||||||||| ||| |||||||||||||||||||||||||||| ||||| |||  |||||||||| | |||||||||||||||||||||    
18326989 aggggtaaccttggcgcaactggtaaagttgttgtcatgtgacttgaaggtcacgggttcaagtcccggaaacagcctcttgtgtaaaaa 18327078  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #32
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 33 - 198
Target Start/End: Complemental strand, 22699151 - 22698983
Alignment:
33 gaggggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaa 132  Q
    |||||||||||| | | ||||||||||||||||||||||||||||  ||||  |   |||||||||||| ||| || ||||||||||||||| |||||||    
22699151 gaggggtaaccttgacgcaactggtaaagttgttgtcatgtgactgaaaggttatgggttcaagtcctggaaatagtctcttgtgtaaaaaacagggtaa 22699052  T
133 ggttgcctacaatacac--taaatgatgggactc-cttcccggaccctgcgtatgcgggagctttagtg 198  Q
    |  ||| ||||||||||   ||||| |||||| |  ||||||||||||| ||||||||||||| |||||    
22699051 gactgcgtacaatacaccaaaaatggtgggacccttttcccggaccctgtgtatgcgggagctatagtg 22698983  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #33
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 46 - 198
Target Start/End: Complemental strand, 42102052 - 42101900
Alignment:
46 ggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaat 145  Q
    |||||||| |||||||||||||||| |||||| ||||| || | |||||||||||| ||||||||||||  |||||||| |||||||   ||| |||| |    
42102052 ggcacaac-ggtaaagttgttgtcacgtgactggaaggtcaaaagttcaagtcctggaaacagcctcttccgtaaaaaacagggtaacactgcgtacagt 42101954  T
146 acactaaa-tgatgggactccttcccggaccctgcgtatgcgggagctttagtg 198  Q
    || ||||| || |||||| | |||||||||||||||||| ||| ||||||||||    
42101953 actctaaagtggtgggaccctttcccggaccctgcgtatccggcagctttagtg 42101900  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #34
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 58 - 213
Target Start/End: Original strand, 11741774 - 11741927
Alignment:
58 aaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacactaaatgat 157  Q
    ||||||||||||||||||||  |||| ||   |||||||||||||||||||| ||| ||||||||  |||||||||| ||| |||||||||| ||||| |    
11741774 aaagttgttgtcatgtgactgaaaggtcatgggttcaagtcctgaaaacagcttctagtgtaaaa--tagggtaaggctgcgtacaatacaccaaatggt 11741871  T
158 gggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgccctt 213  Q
    ||||  ||||||||||  ||||  ||||||||||| ||||| |||  |||||||||    
11741872 gggatcccttcccggattctgcacatgcgggagctctagtgcaccgggttgccctt 11741927  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #35
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 54 - 194
Target Start/End: Original strand, 13805077 - 13805216
Alignment:
54 tggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacactaaa 153  Q
    ||||||||||||||||||||||||  ||||  ||  |||||||||||| ||| ||||||| |||||||| |  |||||||| ||  |||||||||| |||    
13805077 tggtaaagttgttgtcatgtgactgaaaggtaacgggttcaagtcctggaaatagcctctggtgtaaaacag-gggtaaggctgtgtacaatacaccaaa 13805175  T
154 tgatgggactccttcccggaccctgcgtatgcgggagcttt 194  Q
    || ||||||  ||||| ||||||||||||||||||||||||    
13805176 tggtgggaccacttcctggaccctgcgtatgcgggagcttt 13805216  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #36
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 95 - 198
Target Start/End: Original strand, 23231573 - 23231676
Alignment:
95 agtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacactaaatgatgggactccttcccggaccctgcgtatgcgggagcttt 194  Q
    ||||||| ||| |||||||||||||||| ||| ||||||| ||| || |||||||  ||||||||||| |||||||| ||||||||||||||| ||||||    
23231573 agtcctggaaagagcctcttgtgtaaaatataaggtaaggctgcgtataatacaccgaatgatgggaccccttcccgaaccctgcgtatgcggcagcttt 23231672  T
195 agtg 198  Q
    ||||    
23231673 agtg 23231676  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #37
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 32 - 195
Target Start/End: Complemental strand, 28078313 - 28078151
Alignment:
32 tgaggggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggta 131  Q
    ||||||||||||  ||| ||||| || |||||||||||||||||||  |||| |||  |||||||||||  |||||| ||| |||  |||||| ||||||    
28078313 tgaggggtaaccctggcgcaactcgtgaagttgttgtcatgtgactgtaaggtcacgggttcaagtcctagaaacagtctcgtgta-aaaaaacagggta 28078215  T
132 aggttgcctacaatacactaaatgatgggactccttcccggaccctgcgtatgcgggagcttta 195  Q
    ||||||| | |||||||| ||||| |||||| |||||||| | ||||| |||||| ||||||||    
28078214 aggttgcatgcaatacaccaaatggtgggaccccttcccgaatcctgcatatgcgagagcttta 28078151  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #38
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 98 - 195
Target Start/End: Original strand, 38604546 - 38604642
Alignment:
98 cctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacactaaatgatgggactccttcccggaccctgcgtatgcgggagcttta 195  Q
    |||| |||||||||||||||||||||  ||||||||| ||| |||||||||| ||||| || ||| |||| |||||||||||||||||||||||||||    
38604546 cctggaaacagcctcttgtgtaaaaac-agggtaaggctgcgtacaatacaccaaatggtgagacccctttccggaccctgcgtatgcgggagcttta 38604642  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #39
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 37 - 198
Target Start/End: Complemental strand, 14732999 - 14732837
Alignment:
37 ggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggtt 136  Q
    |||||||| ||| ||||||||||||||||||||||||||||  || | ||   |||||||||||| ||||||||||   ||||||||| ||||||||| |    
14732999 ggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaagtcatgggttcaagtcctggaaacagcctcccatgtaaaaaacagggtaaggct 14732900  T
137 gcctacaatacactaaa--tgatgggactccttcccggaccctgcgtatgcgggagctttagtg 198  Q
    || | |||||||| |||  || ||  ||||||||||| ||||||  ||||||||||||||||||    
14732899 gcgt-caatacaccaaaaatggtgaaactccttcccgaaccctgtttatgcgggagctttagtg 14732837  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #40
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 55 - 215
Target Start/End: Original strand, 19265791 - 19265949
Alignment:
55 ggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacactaaat 154  Q
    |||||||||||||||| ||||||  |||| |||  ||||||||| || | |||||| ||||||||||||  ||||||||| ||| |||||||||| ||||    
19265791 ggtaaagttgttgtcacgtgactgaaaggtcacgggttcaagtcttggatacagccgcttgtgtaaaaag-agggtaaggctgcgtacaatacaccaaat 19265889  T
155 gatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgccctttt 215  Q
    | |||||| |||||||||| ||| | |||| ||||||||||||| |||  | |||||||||    
19265890 ggtgggaccccttcccgga-cctacatatgtgggagctttagtgcaccgggctgccctttt 19265949  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #41
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 104 - 216
Target Start/End: Complemental strand, 35787378 - 35787267
Alignment:
104 aacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacactaaatgatgggactccttcccggaccctgcgtatgcgggagctttagtgtacca 203  Q
    ||||||||||||||||||||  | ||||||||||| |||||||||| |||||  ||||| |||||||||||| ||||||||||||||||| | || |||     
35787378 aacagcctcttgtgtaaaaac-atggtaaggttgcgtacaatacaccaaatggcgggaccccttcccggaccttgcgtatgcgggagcttcaatgcaccg 35787280  T
204 tgttgccctttta 216  Q
     ||||||||||||    
35787279 ggttgccctttta 35787267  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #42
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 55 - 190
Target Start/End: Complemental strand, 14099165 - 14099030
Alignment:
55 ggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacactaaat 154  Q
    |||||||||||||||||||||||  |||| ||   ||| |||||||| ||| ||||| |||||||||||| ||| ||||  ||| |||||||||| ||||    
14099165 ggtaaagttgttgtcatgtgactgaaaggtcatgggttgaagtcctggaaatagccttttgtgtaaaaaacaggttaagactgcgtacaatacaccaaat 14099066  T
155 gatgggactccttcccggaccctgcgtatgcgggag 190  Q
    | |||||| |||||||| ||||| ||||||| ||||    
14099065 ggtgggaccccttcccgaaccctacgtatgcaggag 14099030  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #43
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 55 - 190
Target Start/End: Complemental strand, 14409182 - 14409047
Alignment:
55 ggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacactaaat 154  Q
    |||||||||||||||||||||||  |||| ||   ||| |||||||| ||| ||||| |||||||||||| ||| ||||  ||| |||||||||| ||||    
14409182 ggtaaagttgttgtcatgtgactgaaaggtcatgggttgaagtcctggaaatagccttttgtgtaaaaaacaggttaagactgcgtacaatacaccaaat 14409083  T
155 gatgggactccttcccggaccctgcgtatgcgggag 190  Q
    | |||||| |||||||| ||||| ||||||| ||||    
14409082 ggtgggaccccttcccgaaccctacgtatgcaggag 14409047  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #44
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 32 - 123
Target Start/End: Complemental strand, 42496017 - 42495926
Alignment:
32 tgaggggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaa 123  Q
    ||||||||||||| ||| |||||||||||||||||||||| |||||  |||| |||  |||||||||||| |||||||||||||| ||||||    
42496017 tgaggggtaaccttggcgcaactggtaaagttgttgtcatatgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtataaaaa 42495926  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #45
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 91 - 185
Target Start/End: Original strand, 1408469 - 1408563
Alignment:
91 ttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacactaaatgatgggactccttcccggaccctgcgtatgc 185  Q
    ||||||||||| ||| |||||||||||||||||| | ||||||| ||  |||||||||  ||||| |||||| ||||||||||||||||||||||    
1408469 ttcaagtcctggaaatagcctcttgtgtaaaaaacaaggtaaggctgtgtacaatacagcaaatggtgggaccccttcccggaccctgcgtatgc 1408563  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #46
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 54 - 189
Target Start/End: Original strand, 7644931 - 7645066
Alignment:
54 tggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaataca-ctaa 152  Q
    ||||||| ||||||| | ||||||  |||| |||  |||||||||||| |||||||||||||||||||||| |||||||| | || ||||||||| | ||    
7644931 tggtaaatttgttgtaacgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaagatagcgtacaatacaccaaa 7645030  T
153 atgatgggactccttcccggaccctgcgtatgcggga 189  Q
    ||  |||||| |||| || ||||||||||||||||||    
7645031 attgtgggacccctt-cctgaccctgcgtatgcggga 7645066  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #47
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 92 - 198
Target Start/End: Original strand, 18747499 - 18747606
Alignment:
92 tcaagtcctgaaaacagcctcttgtgtaaaaaat-agggtaaggttgcctacaatacactaaatgatgggactccttcccggaccctgcgtatgcgggag 190  Q
    ||||||| || ||||||||| ||||||||||||  ||||||||| ||| || ||||||| || || |||||| |||||| | ||||||||||||||||||    
18747499 tcaagtcttggaaacagccttttgtgtaaaaaagcagggtaaggctgcgtataatacaccaattggtgggaccccttcctgaaccctgcgtatgcgggag 18747598  T
191 ctttagtg 198  Q
    ||||||||    
18747599 ctttagtg 18747606  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #48
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 55 - 190
Target Start/End: Complemental strand, 48123643 - 48123508
Alignment:
55 ggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacactaaat 154  Q
    |||||||||||| ||||||| ||  |||| ||   |||||||||||| ||||||||||||||||||| || |||||||   ||| |||||||||| ||||    
48123643 ggtaaagttgttatcatgtgtctgaaaggtcatgggttcaagtcctggaaacagcctcttgtgtaaataacagggtaaaactgcatacaatacaccaaat 48123544  T
155 gatgggactccttcccggaccctgcgtatgcgggag 190  Q
    | |||||| |||| | ||||| ||| ||||||||||    
48123543 ggtgggacccctttctggaccatgcatatgcgggag 48123508  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #49
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 50 - 124
Target Start/End: Complemental strand, 7794670 - 7794596
Alignment:
50 caactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaa 124  Q
    ||||||||||||||||||| |||||||| ||||| |||  |||||||||||| |||||||||||| |||||||||    
7794670 caactggtaaagttgttgttatgtgactggaaggtcacgggttcaagtcctggaaacagcctcttatgtaaaaaa 7794596  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #50
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 55 - 198
Target Start/End: Complemental strand, 3469338 - 3469191
Alignment:
55 ggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaa--aaaatagggtaaggttgcctacaatacac--t 150  Q
    |||||||||||||||||||||||  |||| ||||   |||||||||  |||||  |||||||||||  |||| |||||| |||||| ||||||||||       
3469338 ggtaaagttgttgtcatgtgactgaaaggtcacagactcaagtcctagaaacattctcttgtgtaaaaaaaacagggtacggttgcgtacaatacaccaa 3469239  T
151 aaatgatgggactccttcccggaccctgcgtatgcgggagctttagtg 198  Q
    |||||  ||||| ||||||  ||||||| |||||||||||||||||||    
3469238 aaatggcgggaccccttcctagaccctgtgtatgcgggagctttagtg 3469191  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #51
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 33 - 134
Target Start/End: Original strand, 7193039 - 7193140
Alignment:
33 gaggggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaa 132  Q
    |||||||||||| |||  |||| ||||||||||||||||||||||  |||| |||  |||||||||||  ||||| ||||||||||||| |||| |||||    
7193039 gaggggtaaccttggcgtaacttgtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctcgaaacaacctcttgtgtaaacaatatggtaa 7193138  T
133 gg 134  Q
    ||    
7193139 gg 7193140  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #52
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 32 - 149
Target Start/End: Original strand, 12473257 - 12473374
Alignment:
32 tgaggggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggta 131  Q
    ||||||||| ||| ||| |||| |||||||||||||||||||  ||  |||| ||   |||||||||||| ||||| |||||||||| ||||| ||||||    
12473257 tgaggggtagccttggcgcaaccggtaaagttgttgtcatgtatctgaaaggtcatgggttcaagtcctgcaaacaacctcttgtgtcaaaaacagggta 12473356  T
132 aggttgcctacaatacac 149  Q
    ||| ||| ||||||||||    
12473357 aggatgcgtacaatacac 12473374  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #53
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 70 - 202
Target Start/End: Original strand, 23223669 - 23223801
Alignment:
70 atgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacactaaatgatgggactccttcc 169  Q
    |||||||  ||||| |||| |||  ||||||||||| ||||||||||||||||||||   ||||||||| |||||||||   |||| ||||| || ||||    
23223669 atgtgaccggaaggtcacaggttagagtcctgaaaagagcctcttgtgtaaaaaataaaataaggttgcgtacaatacatcgaatggtgggattctttcc 23223768  T
170 cggaccctgcgtatgcgggagctttagtgtacc 202  Q
     ||| |||||||||| ||||  |||||||||||    
23223769 tggatcctgcgtatgtgggaattttagtgtacc 23223801  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #54
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 131 - 215
Target Start/End: Complemental strand, 27889399 - 27889315
Alignment:
131 aaggttgcctacaatacactaaatgatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgccctttt 215  Q
    |||| ||| |||||||||| ||||| |||||| ||||||||||||||||||||||||||||||| ||  |||  |||||||||||    
27889399 aaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgcgggagctttggtacaccgggttgccctttt 27889315  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #55
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 54 - 216
Target Start/End: Original strand, 39123865 - 39124032
Alignment:
54 tggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggta----aggttgcctacaatacac 149  Q
    ||||||||||||||||||||||||  || | |||  |||||||||||  |||| | ||||||||||||||  ||||||    ||| ||| || |||||||    
39123865 tggtaaagttgttgtcatgtgactgaaacgacacgggttcaagtcctagaaacggtctcttgtgtaaaaac-agggtagggaaggctgcgtaaaatacac 39123963  T
150 taaa--tgatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgccctttta 216  Q
     |||  || |||||| ||||||||||||||||||||| ||||||||| ||| |||| | ||||||||||    
39123964 caaaaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcaccaagctgccctttta 39124032  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #56
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 34 - 133
Target Start/End: Complemental strand, 5180337 - 5180238
Alignment:
34 aggggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaag 133  Q
    ||||||||||| | | ||||||||||||||||||||||||||||  |||| ||   |||||| | ||| |||||||||||||||| ||||| ||||||||    
5180337 aggggtaaccttgacgcaactggtaaagttgttgtcatgtgactgaaaggtcaagggttcaacttctggaaacagcctcttgtgtcaaaaacagggtaag 5180238  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #57
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 33 - 124
Target Start/End: Original strand, 21447544 - 21447635
Alignment:
33 gaggggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaa 124  Q
    |||||||||||| ||| |||||| |||| |||||||||||| | | ||||| |||   |||||||| |||||||||||||||||||||||||    
21447544 gaggggtaaccttggcgcaactgataaatttgttgtcatgtaattggaaggtcacggattcaagtcttgaaaacagcctcttgtgtaaaaaa 21447635  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #58
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 85 - 198
Target Start/End: Original strand, 21566441 - 21566555
Alignment:
85 cacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacactaaa-tgatgggactccttcccggaccctgcgtat 183  Q
    |||| ||||||||| || |||| ||||||||||||||||| || | |||  ||| |||||||||| ||| || | |||| |||||||| ||||||| |||    
21566441 cacaggttcaagtcttggaaaccgcctcttgtgtaaaaaacagaggaagactgcgtacaatacaccaaaatggtaggaccccttcccgaaccctgcatat 21566540  T
184 gcgggagctttagtg 198  Q
    |||||||||||||||    
21566541 gcgggagctttagtg 21566555  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #59
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 164 - 214
Target Start/End: Complemental strand, 45018973 - 45018923
Alignment:
164 ccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgcccttt 214  Q
    ||||||||||||||||||||||||||||||||||| |||| ||||||||||    
45018973 ccttcccggaccctgcgtatgcgggagctttagtgcaccaggttgcccttt 45018923  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #60
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 308 - 368
Target Start/End: Complemental strand, 42312804 - 42312744
Alignment:
308 aaataacttaaaagaccaatatgttacaaacatcaaacttaaaggacctctgatgtaattt 368  Q
    |||||||||||| ||||||||| |||||||| |||||||||||||||||| | ||||||||    
42312804 aaataacttaaatgaccaatatattacaaacctcaaacttaaaggacctcaggtgtaattt 42312744  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #61
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 55 - 195
Target Start/End: Complemental strand, 44123780 - 44123641
Alignment:
55 ggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacactaaat 154  Q
    |||||||||| ||||||||||||  |||   ||  |||||||| ||| ||||||||||||||||| |||| | ||||||||||| |  ||||||| | ||    
44123780 ggtaaagttggtgtcatgtgactgaaagattacgggttcaagtactggaaacagcctcttgtgta-aaaacaaggtaaggttgcatgaaatacaccatat 44123682  T
155 gatgggactccttcccggaccctgcgtatgcgggagcttta 195  Q
     ||||||| | ||| ||||| |||||||||| |||||||||    
44123681 aatgggacccgttctcggacactgcgtatgcaggagcttta 44123641  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #62
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 50 - 149
Target Start/End: Complemental strand, 1424074 - 1423975
Alignment:
50 caactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacac 149  Q
    ||||||||||||||||||| |||||||| ||||| |||   ||||| ||||| |||||| || |||||||||||| ||||||| | ||| |||| |||||    
1424074 caactggtaaagttgttgttatgtgactggaaggtcacggattcaaatcctggaaacagtctgttgtgtaaaaaacagggtaatgctgcatacactacac 1423975  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #63
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 308 - 355
Target Start/End: Original strand, 6694762 - 6694809
Alignment:
308 aaataacttaaaagaccaatatgttacaaacatcaaacttaaaggacc 355  Q
    |||||||||||| |||||||||||||||||| ||||||||||||||||    
6694762 aaataacttaaaggaccaatatgttacaaacctcaaacttaaaggacc 6694809  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #64
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 308 - 354
Target Start/End: Complemental strand, 29710425 - 29710379
Alignment:
308 aaataacttaaaagaccaatatgttacaaacatcaaacttaaaggac 354  Q
    |||||||||||| ||||||||||||||||| ||||||||||||||||    
29710425 aaataacttaaaggaccaatatgttacaaatatcaaacttaaaggac 29710379  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #65
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 90 - 215
Target Start/End: Complemental strand, 32233258 - 32233134
Alignment:
90 gttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacactaaatgatgggactccttcccggaccctgcgtatgcggga 189  Q
    |||||||||||| ||||| ||||||||||| |||| |||||||||  || || | ||||| ||||| ||||| ||||||||  ||||||| |||| ||||    
32233258 gttcaagtcctggaaacaacctcttgtgta-aaaacagggtaaggcagcgtatattacaccaaatggtgggattccttcccaaaccctgcatatgaggga 32233160  T
190 gctttagtgtaccatgttgccctttt 215  Q
    |||| |||| |||  | |||||||||    
32233159 gcttcagtgcaccgggctgccctttt 32233134  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #66
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 308 - 368
Target Start/End: Complemental strand, 6694576 - 6694516
Alignment:
308 aaataacttaaaagaccaatatgttacaaacatcaaacttaaaggacctctgatgtaattt 368  Q
    |||||||||||||||||||| | |||||||| |||||||||||| ||  ||||||||||||    
6694576 aaataacttaaaagaccaatttattacaaacctcaaacttaaagaacgcctgatgtaattt 6694516  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #67
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 308 - 368
Target Start/End: Complemental strand, 27280659 - 27280599
Alignment:
308 aaataacttaaaagaccaatatgttacaaacatcaaacttaaaggacctctgatgtaattt 368  Q
    |||||||||||| ||||||| ||| |||||| |||||||||||||||| ||| ||||||||    
27280659 aaataacttaaaggaccaatttgtaacaaacttcaaacttaaaggacccctggtgtaattt 27280599  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #68
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 308 - 351
Target Start/End: Complemental strand, 3198316 - 3198273
Alignment:
308 aaataacttaaaagaccaatatgttacaaacatcaaacttaaag 351  Q
    |||||||||||||||||||| |||||||||| ||||||||||||    
3198316 aaataacttaaaagaccaatttgttacaaacctcaaacttaaag 3198273  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #69
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 164 - 211
Target Start/End: Complemental strand, 42495912 - 42495865
Alignment:
164 ccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgccc 211  Q
    ||||||||||||||||||||||||||||||||||| |||  |||||||    
42495912 ccttcccggaccctgcgtatgcgggagctttagtgcaccccgttgccc 42495865  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #70
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 308 - 354
Target Start/End: Complemental strand, 6222125 - 6222079
Alignment:
308 aaataacttaaaagaccaatatgttacaaacatcaaacttaaaggac 354  Q
    |||||||||||||||||||||| |||||||| | |||||||||||||    
6222125 aaataacttaaaagaccaatatattacaaaccttaaacttaaaggac 6222079  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #71
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 308 - 354
Target Start/End: Original strand, 27576623 - 27576669
Alignment:
308 aaataacttaaaagaccaatatgttacaaacatcaaacttaaaggac 354  Q
    |||||||||||| ||||||| |||||||||| |||||||||||||||    
27576623 aaataacttaaaggaccaatctgttacaaacgtcaaacttaaaggac 27576669  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #72
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 36 - 134
Target Start/End: Complemental strand, 29140538 - 29140440
Alignment:
36 gggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaagg 134  Q
    |||||| || ||| |||||||||||||||||||||||| |||  |||| ||||  |||||||  ||||||||  |||||  |||||||||| |||||||    
29140538 gggtaatcttggcgcaactggtaaagttgttgtcatgtaactgaaaggtcacacattcaagttttgaaaacaatctcttaggtaaaaaataaggtaagg 29140440  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #73
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 308 - 354
Target Start/End: Original strand, 29710612 - 29710658
Alignment:
308 aaataacttaaaagaccaatatgttacaaacatcaaacttaaaggac 354  Q
    ||||||| |||||||||||| |||||||||| |||||||||||||||    
29710612 aaataacctaaaagaccaatctgttacaaacgtcaaacttaaaggac 29710658  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #74
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 309 - 354
Target Start/End: Complemental strand, 11975551 - 11975506
Alignment:
309 aataacttaaaagaccaatatgttacaaacatcaaacttaaaggac 354  Q
    ||||||||||| || ||||||||||||||| |||||||||||||||    
11975551 aataacttaaaggatcaatatgttacaaacctcaaacttaaaggac 11975506  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #75
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 90 - 194
Target Start/End: Original strand, 16341289 - 16341394
Alignment:
90 gttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaataca-ctaaatgatgggactccttcccggaccctgcgtatgcggg 188  Q
    |||||||| ||  |||||||||||||||||||||| ||||||||| | | ||||||||| | ||||| |||| |  |||||||||||   | ||||||||    
16341289 gttcaagttctagaaacagcctcttgtgtaaaaaacagggtaaggctacgtacaatacaccaaaatggtgggccctcttcccggacctatcatatgcggg 16341388  T
189 agcttt 194  Q
    ||||||    
16341389 agcttt 16341394  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #76
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 308 - 368
Target Start/End: Complemental strand, 29710365 - 29710305
Alignment:
308 aaataacttaaaagaccaatatgttacaaacatcaaacttaaaggacctctgatgtaattt 368  Q
    |||||||||||| ||  ||| |||||||||| |||||||||||||||| | ||||||||||    
29710365 aaataacttaaaggattaatctgttacaaacgtcaaacttaaaggaccccagatgtaattt 29710305  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #77
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 308 - 368
Target Start/End: Original strand, 31453074 - 31453134
Alignment:
308 aaataacttaaaagaccaatatgttacaaacatcaaacttaaaggacctctgatgtaattt 368  Q
    ||||||||||||  || ||| |||||||||| |||||||||||||||||| ||| ||||||    
31453074 aaataacttaaataactaatctgttacaaacctcaaacttaaaggacctccgatataattt 31453134  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #78
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 167 - 215
Target Start/End: Original strand, 36602535 - 36602583
Alignment:
167 tcccggaccctgcgtatgcgggagctttagtgtaccatgttgccctttt 215  Q
    |||| ||||||||||||||||||||||||||| |||  |||||||||||    
36602535 tcccagaccctgcgtatgcgggagctttagtgcaccgggttgccctttt 36602583  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #79
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 56 - 123
Target Start/End: Original strand, 6736867 - 6736934
Alignment:
56 gtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaa 123  Q
    ||||||||||||||||| ||||  |||| |||  ||||||||||| |||||| |||||||| ||||||    
6736867 gtaaagttgttgtcatgcgactgaaaggtcacgggttcaagtcctcaaaacaacctcttgtataaaaa 6736934  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #80
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 110 - 217
Target Start/End: Complemental strand, 23066029 - 23065922
Alignment:
110 ctcttgtgtaaaaaatagggtaaggttgcctacaatacactaaatgatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgc 209  Q
    ||||||| ||||||| ||| ||| ||||| |||||||||| | |||||||||  |||| ||| | ||||| |||| ||||||||| ||| |||   ||||    
23066029 ctcttgtttaaaaaacaggataaagttgcgtacaatacaccatatgatgggatccctttccgaatcctgcatatgtgggagctttggtgcaccggattgc 23065930  T
210 ccttttat 217  Q
    ||||||||    
23065929 ccttttat 23065922  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #81
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 308 - 351
Target Start/End: Original strand, 30869632 - 30869675
Alignment:
308 aaataacttaaaagaccaatatgttacaaacatcaaacttaaag 351  Q
    |||||||||||| ||||||| |||||||||| ||||||||||||    
30869632 aaataacttaaaggaccaatctgttacaaacctcaaacttaaag 30869675  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #82
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 151 - 198
Target Start/End: Original strand, 33500587 - 33500634
Alignment:
151 aaatgatgggactccttcccggaccctgcgtatgcgggagctttagtg 198  Q
    ||||| |||||| |||||||||||||||||||||||||| ||| ||||    
33500587 aaatggtgggaccccttcccggaccctgcgtatgcgggatcttcagtg 33500634  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #83
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 308 - 354
Target Start/End: Original strand, 11975673 - 11975719
Alignment:
308 aaataacttaaaagaccaatatgttacaaacatcaaacttaaaggac 354  Q
    |||||||||||| |||||||  ||||||||| |||||||||||||||    
11975673 aaataacttaaaggaccaatcagttacaaacctcaaacttaaaggac 11975719  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #84
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 307 - 357
Target Start/End: Original strand, 41666375 - 41666425
Alignment:
307 gaaataacttaaaagaccaatatgttacaaacatcaaacttaaaggacctc 357  Q
    ||||||||||||  ||| ||| |||||||||| ||||||||||||||||||    
41666375 gaaataacttaagggacaaatctgttacaaacctcaaacttaaaggacctc 41666425  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #85
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 310 - 351
Target Start/End: Complemental strand, 4048305 - 4048264
Alignment:
310 ataacttaaaagaccaatatgttacaaacatcaaacttaaag 351  Q
    |||||||||| |||||||||||||||||| ||| ||||||||    
4048305 ataacttaaaggaccaatatgttacaaacctcagacttaaag 4048264  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #86
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 308 - 353
Target Start/End: Original strand, 6069293 - 6069338
Alignment:
308 aaataacttaaaagaccaatatgttacaaacatcaaacttaaagga 353  Q
    |||||||||||| |||  ||||||||||||| ||||||||||||||    
6069293 aaataacttaaatgacatatatgttacaaacctcaaacttaaagga 6069338  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #87
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 116 - 203
Target Start/End: Complemental strand, 17048914 - 17048826
Alignment:
116 tgtaaaaaatagggtaaggttgcctacaataca-ctaaatgatgggactccttcccggaccctgcgtatgcgggagctttagtgtacca 203  Q
    ||||||||| ||||||||||| | ||||||||| | ||||| ||| || |||||||||| | ||| ||||  |||||||||||| ||||    
17048914 tgtaaaaaacagggtaaggttacgtacaatacaccaaaatggtggaaccccttcccggaacttgcttatgtaggagctttagtgaacca 17048826  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #88
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 308 - 368
Target Start/End: Original strand, 27280901 - 27280961
Alignment:
308 aaataacttaaaagaccaatatgttacaaacatcaaacttaaaggacctctgatgtaattt 368  Q
    |||||||||||| |  |||  |||||||||| |||||||||||||||||||  ||||||||    
27280901 aaataacttaaagggtcaagctgttacaaacctcaaacttaaaggacctctagtgtaattt 27280961  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #89
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 308 - 368
Target Start/End: Original strand, 30869692 - 30869752
Alignment:
308 aaataacttaaaagaccaatatgttacaaacatcaaacttaaaggacctctgatgtaattt 368  Q
    |||||||||||| |||||||   |||||||| |||||||||||||| ||| ||| ||||||    
30869692 aaataacttaaaggaccaatcaattacaaacctcaaacttaaaggaactcagatataattt 30869752  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #90
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 90 - 195
Target Start/End: Original strand, 35203450 - 35203557
Alignment:
90 gttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacac--taaatgatgggactccttcccggaccctgcgtatgcgg 187  Q
    |||||||||||| |||||  ||||||||||||||| ||| ||||  ||| ||||||| ||   ||||| |||||  |||||| | || || |||||||||    
35203450 gttcaagtcctggaaacattctcttgtgtaaaaaacaggataagactgcgtacaatataccaaaaatggtgggatcccttcctgaactctacgtatgcgg 35203549  T
188 gagcttta 195  Q
    ||||||||    
35203550 gagcttta 35203557  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #91
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 151 - 207
Target Start/End: Original strand, 47514793 - 47514848
Alignment:
151 aaatgatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgtt 207  Q
    ||||| |||||||| |||||| ||||||||||| ||| |||||||||| ||||||||    
47514793 aaatggtgggactcattcccgaaccctgcgtat-cggaagctttagtgcaccatgtt 47514848  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 97; Significance: 2e-47; HSPs: 71)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 97; E-Value: 2e-47
Query Start/End: Original strand, 33 - 216
Target Start/End: Complemental strand, 1354936 - 1354755
Alignment:
33 gaggggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaa 132  Q
    |||||||||||| ||| ||||||||||||||||||||||||||||  |||| |||  |||||||||||| ||||||||||||||||  |||| |||||||    
1354936 gaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcactggttcaagtcctggaaacagcctcttgtgt--aaaacagggtaa 1354839  T
133 ggttgcctacaatacactaaatgatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgccctttta 216  Q
    || ||| |||||||||| ||||| |||||| |||||||||||||||| |||||||||||| ||||| |||  ||||||||||||    
1354838 ggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctttta 1354755  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 96; E-Value: 6e-47
Query Start/End: Original strand, 32 - 215
Target Start/End: Complemental strand, 29356040 - 29355854
Alignment:
32 tgaggggtaacctcggcacaactggtaaag-ttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggt 130  Q
    ||||||||||||| |||||||||||||||  ||||||||||||||||  |||| |||  |||||||||||| |||||||||||||||||| ||| |||||    
29356040 tgaggggtaaccttggcacaactggtaaaaattgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaagaaacagggt 29355941  T
131 aaggttgcctacaatacacta--aatgatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgccctttt 215  Q
    |||| ||| |||||||||| |  |||| |||||| ||||||||||||||||||||||||||||||||||| |||  |||||||||||    
29355940 aaggctgcgtacaatacaccaataatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctttt 29355854  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 33 - 215
Target Start/End: Original strand, 1346918 - 1347098
Alignment:
33 gaggggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaa 132  Q
    |||||||||||| ||| ||||||||||||||||||||||||||||  |||| |||  |||||||||||| |||||||| |||||||  |||| |||||||    
1346918 gaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagccacttgtgt--aaaacagggtaa 1347015  T
133 ggttgcctacaatacactaaatgatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgccctttt 215  Q
    || ||| |||||||||| ||||| |||||| |||||||||||||||| |||||||||||| ||||| |||  |||||||||||    
1347016 ggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctttt 1347098  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 86; E-Value: 6e-41
Query Start/End: Original strand, 50 - 215
Target Start/End: Complemental strand, 12222081 - 12221913
Alignment:
50 caactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacac 149  Q
    ||||||||||||||||||||||||||||  |||| |||  ||||||||| || |||||||||||||||||||||| ||||||||| ||| ||||||||||    
12222081 caactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcttggaaacagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacac 12221982  T
150 ta--aatgatgggactccttcccggaccctgcgtatgcgggagc-tttagtgtaccatgttgccctttt 215  Q
     |  |||| |||||| |||||||||||||||||||||||||||| ||||||| |||  |||||||||||    
12221981 caataatggtgggaccccttcccggaccctgcgtatgcgggagcttttagtgcaccgggttgccctttt 12221913  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 79; E-Value: 8e-37
Query Start/End: Original strand, 32 - 215
Target Start/End: Original strand, 9161076 - 9161260
Alignment:
32 tgaggggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggta 131  Q
    ||||||||||||| | | |||  |||||||||||||||||||||||  |||| |||| |||||||||||| |||||||||||||||| ||||| || |||    
9161076 tgaggggtaaccttgacgcaatcggtaaagttgttgtcatgtgactgaaaggtcacaggttcaagtcctggaaacagcctcttgtgt-aaaaacagagta 9161174  T
132 aggttgcctacaatacacta--aatgatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgccctttt 215  Q
    ||| ||| |||||||||  |  |||| |||||| ||||| |||||||||||||||||| |||||||||| |||| |||||||||||    
9161175 aggctgcgtacaatacatcaataatggtgggaccccttctcggaccctgcgtatgcggaagctttagtgcaccaggttgccctttt 9161260  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 35 - 198
Target Start/End: Complemental strand, 3815256 - 3815093
Alignment:
35 ggggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaagg 134  Q
    |||||||||| ||| ||||||||||||||||||||||||||||  || | |||  |||||||||||| |||||| || |||||||||||||| |||| |     
3815256 ggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaagtcctggaaacagactattgtgtaaaaaatatggtacga 3815157  T
135 ttgcctacaatacactaaatgatgggactccttcccggaccctgcgtatgcgggagctttagtg 198  Q
     ||| |||||||||| ||||| |||||| | |||||| ||||| ||||||||| ||||||||||    
3815156 ctgcgtacaatacaccaaatggtgggaccctttcccgaaccctacgtatgcggaagctttagtg 3815093  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #7
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 50 - 215
Target Start/End: Complemental strand, 2166576 - 2166409
Alignment:
50 caactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacac 149  Q
    ||||| ||||||||||||| ||||||||  |||| |||  |||||||||||| ||||| |||||||||||||| | ||| ||||||||| ||||||||||    
2166576 caactagtaaagttgttgttatgtgactgaaaggtcacgggttcaagtcctggaaacaacctcttgtgtaaaatacaggataaggttgcgtacaatacac 2166477  T
150 ta--aatgatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgccctttt 215  Q
     |  |||| |||||| ||||||||||||||   ||| |||||||||||||| |||  |||||||||||    
2166476 caataatggtgggaccccttcccggaccctatatattcgggagctttagtgcaccgggttgccctttt 2166409  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #8
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 50 - 215
Target Start/End: Complemental strand, 2178209 - 2178042
Alignment:
50 caactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacac 149  Q
    ||||| ||||||||||||| ||||||||  |||| |||  |||||||||||| ||||| |||||||||||||| | ||| ||||||||| ||||||||||    
2178209 caactagtaaagttgttgttatgtgactgaaaggtcacgggttcaagtcctggaaacaacctcttgtgtaaaatacaggataaggttgcgtacaatacac 2178110  T
150 ta--aatgatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgccctttt 215  Q
     |  |||| |||||| ||||||||||||||   ||| |||||||||||||| |||  |||||||||||    
2178109 caataatggtgggaccccttcccggaccctatatattcgggagctttagtgcaccgggttgccctttt 2178042  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #9
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 46 - 215
Target Start/End: Original strand, 24097548 - 24097713
Alignment:
46 ggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaat 145  Q
    ||||||||||||||| ||| |||||||| |||  |||| |||  ||| |||||||  || ||||||||||| ||||||| ||||||||| ||| |||||     
24097548 ggcacaactggtaaaattgatgtcatgttactgaaaggtcacgagtttaagtcctcgaaccagcctcttgtataaaaaacagggtaaggctgcttacaa- 24097646  T
146 acactaaatgatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgccctttt 215  Q
       | ||||| |||||| |||||||||||||||||||||||| ||||||||||| ||| |||||||||||    
24097647 ---ccaaatggtgggaccccttcccggaccctgcgtatgcggaagctttagtgtcccaggttgccctttt 24097713  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #10
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 33 - 215
Target Start/End: Original strand, 1941809 - 1941991
Alignment:
33 gaggggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaa 132  Q
    |||||||||||| ||  |||||||||||||||||||||| ||||| ||||| | |   || ||||| || ||||| |||||||||||||||| |||||||    
1941809 gaggggtaaccttggtgcaactggtaaagttgttgtcatctgactggaaggtcgcggattgaagtcatgtaaacaacctcttgtgtaaaaaacagggtaa 1941908  T
133 ggttgcctacaatacactaaatgatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgccctttt 215  Q
    || ||| ||||||||||  |||| |||||| || ||| ||| | || ||||||||||| ||| ||| ||| ||||||||||||    
1941909 ggctgcgtacaatacaccgaatggtgggaccccatcctggatcttgtgtatgcgggagtttttgtgcaccgtgttgccctttt 1941991  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #11
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 46 - 198
Target Start/End: Original strand, 12889394 - 12889546
Alignment:
46 ggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaat 145  Q
    |||||||| |||||||||||||||| |||| |  |||| |||| ||||||||| ||||||||||||||||||| ||||| |||| |||| ||| ||||||    
12889394 ggcacaac-ggtaaagttgttgtcacgtgagtgaaaggtcacaggttcaagtcttgaaaacagcctcttgtgttaaaaacagggcaaggctgcatacaat 12889492  T
146 aca-ctaaatgatgggactccttcccggaccctgcgtatgcgggagctttagtg 198  Q
    ||| ||||| |||||||| |||| |||||||||  || || |||||||||||||    
12889493 acacctaaacgatgggacccctttccggaccctctgtgtgtgggagctttagtg 12889546  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #12
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 50 - 192
Target Start/End: Original strand, 14553483 - 14553626
Alignment:
50 caactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacac 149  Q
    ||||||||||||||||||||||||||||| |||| |||| |||||||||||| ||| ||| |||||||||||||||||||||||| ||  || |||||||    
14553483 caactggtaaagttgttgtcatgtgacta-aaggtcacaggttcaagtcctggaaatagcttcttgtgtaaaaaatagggtaaggctgtgtataatacac 14553581  T
150 taaa--tgatgggactccttcccggaccctgcgtatgcgggagct 192  Q
     |||  || |||||| |||||   ||||||| |||||||||||||    
14553582 caaaactggtgggaccccttcgtagaccctgtgtatgcgggagct 14553626  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #13
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 32 - 147
Target Start/End: Original strand, 8409196 - 8409311
Alignment:
32 tgaggggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggta 131  Q
    ||||||||||||| ||| ||||||||||||||||||| ||||||||  |||| |||   ||||||||||| |||| ||||||||||||||||| ||||||    
8409196 tgaggggtaaccttggcgcaactggtaaagttgttgtaatgtgactgaaaggtcacggattcaagtcctggaaactgcctcttgtgtaaaaaacagggta 8409295  T
132 aggttgcctacaatac 147  Q
    ||| ||| ||||||||    
8409296 aggctgcgtacaatac 8409311  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #14
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 97 - 215
Target Start/End: Original strand, 26097178 - 26097294
Alignment:
97 tcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacactaaatgatgggactccttcccggaccctgcgtatgcgggagctttag 196  Q
    ||||| |||||||||||||||||||| |  |||||||| ||| |||||||||| |||||| ||||| |||||||||||||||| |||||||||||| |||    
26097178 tcctggaaacagcctcttgtgtaaaaca--gggtaaggctgcgtacaatacaccaaatgaagggaccccttcccggaccctgcatatgcgggagctctag 26097275  T
197 tgtaccatgttgccctttt 215  Q
    || |||  |||||||||||    
26097276 tgcaccgggttgccctttt 26097294  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #15
Raw Score: 59; E-Value: 7e-25
Query Start/End: Original strand, 33 - 198
Target Start/End: Complemental strand, 15866218 - 15866055
Alignment:
33 gaggggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaa 132  Q
    |||||||||||| ||| |||||||||||||||||| ||||||| |  |||| ||   |||||| ||||| ||||||||||||  |||||||| |||||||    
15866218 gaggggtaaccttggcccaactggtaaagttgttggcatgtgattgaaaggtcatgggttcaattcctggaaacagcctcttaagtaaaaaacagggtaa 15866119  T
133 ggttgcctacaatacactaaatgatgggactccttcccggaccctgcgtatgcgggagctttagtg 198  Q
     | ||| ||  |||||| ||||| |||||| |||||||||||||||||| ||||||| || |||||    
15866118 agctgcgta--atacaccaaatggtgggaccccttcccggaccctgcgtttgcgggatctatagtg 15866055  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #16
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 97 - 215
Target Start/End: Original strand, 25557743 - 25557859
Alignment:
97 tcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacactaaatgatgggactccttcccggaccctgcgtatgcgggagctttag 196  Q
    ||||| |||||||||||||||||||| |  |||||||| ||| |||||||||| |||||| || || |||||||||||||||| |||||||||||| |||    
25557743 tcctggaaacagcctcttgtgtaaaaca--gggtaaggctgcgtacaatacaccaaatgaaggaaccccttcccggaccctgcatatgcgggagctctag 25557840  T
197 tgtaccatgttgccctttt 215  Q
    || |||  |||||||||||    
25557841 tgcaccgggttgccctttt 25557859  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #17
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 34 - 183
Target Start/End: Complemental strand, 13905158 - 13905011
Alignment:
34 aggggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaag 133  Q
    ||||| ||||| ||| |||| |||||||||||||||||||||||  |||| |||  | |||||||||||||||  |||||||||||||||| ||||||||    
13905158 agggggaaccttggcgcaac-ggtaaagttgttgtcatgtgactgaaaggtcacgggctcaagtcctgaaaacgacctcttgtgtaaaaaacagggtaag 13905060  T
134 gttgcctacaatacactaaatgatgggactccttcccggaccctgcgtat 183  Q
    | ||| |||||| ||| ||||| | |||| | |||||| |||||||||||    
13905059 gctgcatacaattcaccaaatggt-ggaccctttcccgaaccctgcgtat 13905011  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #18
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 32 - 124
Target Start/End: Complemental strand, 14975262 - 14975170
Alignment:
32 tgaggggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaa 124  Q
    |||||| |||||| ||| |||| ||||||||||||||||||||||| ||||| |||   ||||||||||| ||||||||||||||||||||||    
14975262 tgagggataaccttggcgcaaccggtaaagttgttgtcatgtgactggaaggtcacggattcaagtcctggaaacagcctcttgtgtaaaaaa 14975170  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #19
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 37 - 217
Target Start/End: Complemental strand, 23930303 - 23930124
Alignment:
37 ggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttc-aagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggt 135  Q
    |||||||| ||| |||||  ||||| |||||||||||| ||  |||| |||  |||| ||||| || |||||| ||| ||||||||||| | | ||  ||    
23930303 ggtaaccttggcgcaactcataaagatgttgtcatgtgtctcaaaggtcacgagttccaagtcatggaaacagtctcatgtgtaaaaaacaagata--gt 23930206  T
136 tgcctacaatacactaaatgatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgcccttttat 217  Q
    ||| |||||||||| | ||| |||||| ||||| |||||||||| |||||||||||||||||| |||  |||||||||||||    
23930205 tgcgtacaatacaccagatggtgggaccccttcacggaccctgcttatgcgggagctttagtgcaccgagttgcccttttat 23930124  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #20
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 50 - 176
Target Start/End: Original strand, 6024204 - 6024332
Alignment:
50 caactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacac 149  Q
    |||||||||||||||||||||||||| | ||||| |||   ||||| ||||  |||||||||||||||||||||| | ||||||  ||| ||||||||||    
6024204 caactggtaaagttgttgtcatgtgattggaaggtcacggtttcaaatcctagaaacagcctcttgtgtaaaaaacatggtaagactgcgtacaatacac 6024303  T
150 ta--aatgatgggactccttcccggaccc 176  Q
     |  |||||||||||  ||||||||||||    
6024304 caataatgatgggacctcttcccggaccc 6024332  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #21
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 106 - 198
Target Start/End: Original strand, 19340855 - 19340947
Alignment:
106 cagcctcttgtgtaaaaaatagggtaaggttgcctacaatacactaaa-tgatgggactccttcccggaccctgcgtatgcgggagctttagtg 198  Q
    ||||||||||||||||||| |||||||||||||  ||||||||| ||| ||||||||| |||||| |||||| |||||||||| ||||||||||    
19340855 cagcctcttgtgtaaaaaacagggtaaggttgca-acaatacaccaaaatgatgggaccccttcctggacccggcgtatgcggaagctttagtg 19340947  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #22
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 64 - 195
Target Start/End: Complemental strand, 18277343 - 18277212
Alignment:
64 gttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacactaaatgatgggact 163  Q
    |||||| |||||||| |||| |||  |||||| || || |||||||||||||||||||||  ||||||||||||  ||||  |||| ||||| ||||||     
18277343 gttgtcctgtgactaaaaggtcacgggttcaaatcttggaaacagcctcttgtgtaaaaatcagggtaaggttgagtacagaacaccaaatggtgggacc 18277244  T
164 ccttcccggaccctgcgtatgcgggagcttta 195  Q
    ||||||  ||| || |||||||||||||||||    
18277243 ccttcctagactctacgtatgcgggagcttta 18277212  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #23
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 90 - 197
Target Start/End: Original strand, 32579437 - 32579543
Alignment:
90 gttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacactaaatgatgggactccttcccggaccctgcgtatgcggga 189  Q
    |||||||||||| ||||||||||| || |||||| || ||||||  ||| |||||||| | ||||| |||||| ||||||| |||||||| |||||||||    
32579437 gttcaagtcctggaaacagcctctggtataaaaa-tacggtaagcctgcgtacaataccccaaatggtgggaccccttcccagaccctgcatatgcggga 32579535  T
190 gctttagt 197  Q
    ||||||||    
32579536 gctttagt 32579543  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #24
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 56 - 215
Target Start/End: Complemental strand, 32728314 - 32728156
Alignment:
56 gtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacactaaatg 155  Q
    ||||||||||||||||||||||  |||| ||||  |||||||  || ||||| |||||| ||||||||| ||||||||  ||  ||||||| || ||||     
32728314 gtaaagttgttgtcatgtgactgaaaggtcacagattcaagttttggaaacaacctcttatgtaaaaaacagggtaagactgtgtacaatataccaaata 32728215  T
156 atgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgccctttt 215  Q
     |||  | | ||||| |||||| ||||||||||| |||||||| ||||||||||||||||    
32728214 gtggtcc-ctttcccagaccctacgtatgcgggaactttagtgcaccatgttgccctttt 32728156  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #25
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 65 - 198
Target Start/End: Complemental strand, 23240971 - 23240840
Alignment:
65 ttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacactaaatgatgggactc 164  Q
    |||||| ||||||  |||| |||| || ||||||||| |||||||||||||||||||| |  ||||||| |||| ||||||| || || || |||||| |    
23240971 ttgtcacgtgactgaaaggtcacaggtgcaagtcctggaaacagcctcttgtgtaaaaca--gggtaagtttgcgtacaatataccaattggtgggaccc 23240874  T
165 cttcccggaccctgcgtatgcgggagctttagtg 198  Q
    ||||  ||||  ||||||||||||||||||||||    
23240873 cttctaggacaatgcgtatgcgggagctttagtg 23240840  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #26
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 90 - 198
Target Start/End: Complemental strand, 7947496 - 7947387
Alignment:
90 gttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacactaaa-tgatgggactccttcccggaccctgcgtatgcggg 188  Q
    |||||| ||||| ||||| |||| ||||||||||  ||||||||| ||| |||||||||| ||| || |||| | |||||||||||| |||||||| |||    
7947496 gttcaactcctggaaacaacctcctgtgtaaaaaccagggtaaggctgcgtacaatacaccaaaatggtgggcccccttcccggaccttgcgtatgtggg 7947397  T
189 agctttagtg 198  Q
    ||||||||||    
7947396 agctttagtg 7947387  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #27
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 37 - 154
Target Start/End: Original strand, 20400625 - 20400742
Alignment:
37 ggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggtt 136  Q
    |||||||| ||| ||| ||||| ||||||||||||||||||  |||| |||| ||||||||  || |||||  ||||||||||||||| ||||||||  |    
20400625 ggtaaccttggcgcaattggtatagttgttgtcatgtgactgaaaggtcacaggttcaagttatggaaacaatctcttgtgtaaaaaacagggtaagact 20400724  T
137 gcctacaatacactaaat 154  Q
    || |||| ||||||||||    
20400725 gcgtacagtacactaaat 20400742  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #28
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 308 - 368
Target Start/End: Original strand, 21598738 - 21598798
Alignment:
308 aaataacttaaaagaccaatatgttacaaacatcaaacttaaaggacctctgatgtaattt 368  Q
    |||||||||||| ||||||| |||||||||| |||||||||||||||| ||||||||||||    
21598738 aaataacttaaaggaccaatctgttacaaacctcaaacttaaaggacccctgatgtaattt 21598798  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #29
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 90 - 198
Target Start/End: Original strand, 33138844 - 33138952
Alignment:
90 gttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacactaaatgatgggactccttcccggaccctgcgtatgcggga 189  Q
    |||||||||||| ||||| |||||||| ||||||| || ||||||  || |||||||||| ||||| |||||| | || |||||||||| |||||| | |    
33138844 gttcaagtcctggaaacaacctcttgtataaaaaacagagtaaggccgcgtacaatacaccaaatggtgggacccttttccggaccctgtgtatgcagta 33138943  T
190 gctttagtg 198  Q
    |||||||||    
33138944 gctttagtg 33138952  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #30
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 142 - 215
Target Start/End: Original strand, 13267788 - 13267861
Alignment:
142 caatacactaaatgatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgccctttt 215  Q
    |||||||| ||||| |||||| |||||| ||||||||||||||||||||||| |||| |||  |||||||||||    
13267788 caatacaccaaatggtgggaccccttcctggaccctgcgtatgcgggagcttcagtgcaccgggttgccctttt 13267861  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #31
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 308 - 368
Target Start/End: Original strand, 10356554 - 10356614
Alignment:
308 aaataacttaaaagaccaatatgttacaaacatcaaacttaaaggacctctgatgtaattt 368  Q
    ||||||| |||| ||||||| |||||||||| |||||||||||||||||| ||||||||||    
10356554 aaataacctaaaggaccaatctgttacaaacgtcaaacttaaaggacctcagatgtaattt 10356614  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #32
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 308 - 368
Target Start/End: Complemental strand, 13273113 - 13273053
Alignment:
308 aaataacttaaaagaccaatatgttacaaacatcaaacttaaaggacctctgatgtaattt 368  Q
    |||||| | ||||||||||| | ||||||||||||||||||||||||||||| ||||||||    
13273113 aaataattcaaaagaccaatctattacaaacatcaaacttaaaggacctctggtgtaattt 13273053  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #33
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 152 - 215
Target Start/End: Original strand, 6808468 - 6808531
Alignment:
152 aatgatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgccctttt 215  Q
    |||| |||||| ||||||||||||||| ||||||||||||||||||| |||  |||||||||||    
6808468 aatggtgggaccccttcccggaccctgtgtatgcgggagctttagtgcaccgggttgccctttt 6808531  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #34
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 30 - 190
Target Start/End: Original strand, 22967122 - 22967287
Alignment:
30 tttgaggggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaataggg 129  Q
    |||||||||||||||  || || ||| ||||||| |||||||||||||  |||| |||  ||||||||| || ||||| | |||||||| |||||||||     
22967122 tttgaggggtaaccttcgcgcatctgataaagttattgtcatgtgactgtaaggtcactagttcaagtcatggaaacaacttcttgtgt-aaaaatagga 22967220  T
130 taaggttgc------ctacaatacactaaatgatgggactccttcccggaccctgcgtatgcgggag 190  Q
    ||||| |||       |||||||||| ||||| |||||| |||||  ||||||||| ||||||||||    
22967221 taaggctgcatacaaatacaatacaccaaatggtgggaccccttcttggaccctgcctatgcgggag 22967287  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #35
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 30 - 190
Target Start/End: Complemental strand, 23821271 - 23821106
Alignment:
30 tttgaggggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaataggg 129  Q
    |||||||||||||||  || || ||| ||||||| |||||||||||||  |||| |||  ||||||||| || ||||| | ||||||||| ||||||||     
23821271 tttgaggggtaaccttcgcgcatctgataaagttattgtcatgtgactgtaaggtcactagttcaagtcatggaaacaacttcttgtgta-aaaatagga 23821173  T
130 taaggttgc------ctacaatacactaaatgatgggactccttcccggaccctgcgtatgcgggag 190  Q
    ||||| |||       |||||||||| ||||| |||||| |||||  ||||||||| ||||||||||    
23821172 taaggctgcatacaaatacaatacaccaaatggtgggaccccttcttggaccctgcctatgcgggag 23821106  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #36
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 37 - 124
Target Start/End: Original strand, 24734591 - 24734678
Alignment:
37 ggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaa 124  Q
    |||||| | ||| ||||||||||||||||||||||||||||  |||| || | |||||| ||||  ||||| ||||||||||||||||    
24734591 ggtaacattggcgcaactggtaaagttgttgtcatgtgactgaaaggtcaaaagttcaaatccttgaaacaacctcttgtgtaaaaaa 24734678  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #37
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 151 - 216
Target Start/End: Original strand, 12885985 - 12886050
Alignment:
151 aaatgatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgccctttta 216  Q
    ||||| |||||| ||||||| ||||||||||||| ||||||||||||| |||  ||||||||||||    
12885985 aaatggtgggaccccttcccagaccctgcgtatgtgggagctttagtgcaccgggttgccctttta 12886050  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #38
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 57 - 170
Target Start/End: Original strand, 28007604 - 28007717
Alignment:
57 taaagttgttgtcatgtgactagaa--ggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacactaaat 154  Q
    ||||||||||||||||||||  |||  || |||  |||||||||||| ||| ||||||||||||  |||| ||||| ||| ||| |||||||||| ||||    
28007604 taaagttgttgtcatgtgacatgaaaaggtcacgggttcaagtcctggaaagagcctcttgtgt--aaaacagggtcaggctgcgtacaatacaccaaat 28007701  T
155 gatgggactccttccc 170  Q
    | |||||| |||||||    
28007702 gctgggaccccttccc 28007717  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #39
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 152 - 215
Target Start/End: Original strand, 12892082 - 12892145
Alignment:
152 aatgatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgccctttt 215  Q
    |||| |||||| ||||||||||||| || |||||||||||||||||| |||  |||||||||||    
12892082 aatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccgggttgccctttt 12892145  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #40
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 308 - 355
Target Start/End: Complemental strand, 35225443 - 35225396
Alignment:
308 aaataacttaaaagaccaatatgttacaaacatcaaacttaaaggacc 355  Q
    |||||||||||| ||||||| |||||||||| ||||||||||||||||    
35225443 aaataacttaaaggaccaatttgttacaaacctcaaacttaaaggacc 35225396  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #41
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 102 - 195
Target Start/End: Complemental strand, 9671197 - 9671103
Alignment:
102 aaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaataca-ctaaatgatgggactccttcccggaccctgcgtatgcgggagcttta 195  Q
    ||||||||||||||||||||||| ||||||||| |||||||  |||| | ||||| | |||| |||| ||| |||||||  || |||||||||||    
9671197 aaaacagcctcttgtgtaaaaaacagggtaaggctgcctactttacatcaaaatggtaggacccctttccgaaccctgcaaatacgggagcttta 9671103  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #42
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 308 - 354
Target Start/End: Original strand, 10356494 - 10356540
Alignment:
308 aaataacttaaaagaccaatatgttacaaacatcaaacttaaaggac 354  Q
    |||||||||||||||||||| |||||||||  |||||||||||||||    
10356494 aaataacttaaaagaccaatctgttacaaatctcaaacttaaaggac 10356540  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #43
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 89 - 215
Target Start/End: Original strand, 12228368 - 12228494
Alignment:
89 tgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacactaaatgatgggactccttcccggaccctgcgtatgcggg 188  Q
    |||||||||  || |||||| ||||||| ||||||||||| ||| ||||| |||||||||| | ||  |||||| |||||||  | ||| |||| | |||    
12228368 tgttcaagttttggaaacagactcttgtttaaaaaataggataaagttgcgtacaatacaccagatagtgggaccccttcccataacctacgtaagtggg 12228467  T
189 agctttagtgtaccatgttgccctttt 215  Q
    || ||||||||||   |||||||||||    
12228468 agttttagtgtactgggttgccctttt 12228494  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #44
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 308 - 354
Target Start/End: Complemental strand, 21598550 - 21598504
Alignment:
308 aaataacttaaaagaccaatatgttacaaacatcaaacttaaaggac 354  Q
    |||||||||||| ||||||| |||||||||| |||||||||||||||    
21598550 aaataacttaaaggaccaatctgttacaaacctcaaacttaaaggac 21598504  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #45
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 308 - 354
Target Start/End: Original strand, 21598678 - 21598724
Alignment:
308 aaataacttaaaagaccaatatgttacaaacatcaaacttaaaggac 354  Q
    |||||||||||| ||||||||||||||||||  ||||||||||||||    
21598678 aaataacttaaaggaccaatatgttacaaaccacaaacttaaaggac 21598724  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #46
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 55 - 198
Target Start/End: Complemental strand, 2755583 - 2755436
Alignment:
55 ggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacac--taa 152  Q
    |||||||||||||||||||||||  |||| |  | ||||||||| || ||||| |||||| |   ||||||||| ||||| ||| ||||||||||   ||    
2755583 ggtaaagttgttgtcatgtgactgaaaggtcgtaggttcaagtcttgcaaacatcctcttataccaaaaataggctaaggctgcgtacaatacaccaaaa 2755484  T
153 atgatgggactccttcccggaccctgcgtat--gcgggagctttagtg 198  Q
    ||| ||||| ||||||||  | ||||| |||  |||||||||||||||    
2755483 atggtgggagtccttcccaaatcctgcatatgcgcgggagctttagtg 2755436  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #47
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 164 - 197
Target Start/End: Complemental strand, 10734955 - 10734922
Alignment:
164 ccttcccggaccctgcgtatgcgggagctttagt 197  Q
    ||||||||||||||||||||||||||||||||||    
10734955 ccttcccggaccctgcgtatgcgggagctttagt 10734922  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #48
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 61 - 153
Target Start/End: Complemental strand, 4136670 - 4136578
Alignment:
61 gttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacactaaa 153  Q
    ||||||| || ||||||| || | |||  ||||||||||| |||||| | |||||||||||| | ||||||||||||| || | |||||||||    
4136670 gttgttgccacgtgactaaaatgtcacgggttcaagtcctaaaaacaacatcttgtgtaaaatacagggtaaggttgcgtagagtacactaaa 4136578  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #49
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 308 - 368
Target Start/End: Complemental strand, 9982715 - 9982655
Alignment:
308 aaataacttaaaagaccaatatgttacaaacatcaaacttaaaggacctctgatgtaattt 368  Q
    |||||| ||||| ||  |||||||||||||| ||||||||||| ||||| |||||||||||    
9982715 aaataatttaaaggatgaatatgttacaaacctcaaacttaaaagacctatgatgtaattt 9982655  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #50
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 157 - 197
Target Start/End: Original strand, 11395839 - 11395879
Alignment:
157 tgggactccttcccggaccctgcgtatgcgggagctttagt 197  Q
    |||||| |||||||||| |||||||||||||||||||||||    
11395839 tgggaccccttcccggatcctgcgtatgcgggagctttagt 11395879  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #51
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 308 - 368
Target Start/End: Complemental strand, 17136889 - 17136829
Alignment:
308 aaataacttaaaagaccaatatgttacaaacatcaaacttaaaggacctctgatgtaattt 368  Q
    |||||||||||| ||| ||| | |||||||| ||||| |||||||||||||| ||||||||    
17136889 aaataacttaaaggactaatctattacaaacctcaaatttaaaggacctctggtgtaattt 17136829  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #52
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 307 - 350
Target Start/End: Original strand, 17342672 - 17342715
Alignment:
307 gaaataacttaaaagaccaatatgttacaaacatcaaacttaaa 350  Q
    ||||||||||||| |||||| ||||||||||| |||||||||||    
17342672 gaaataacttaaaggaccaacatgttacaaacctcaaacttaaa 17342715  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #53
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 308 - 351
Target Start/End: Original strand, 17342733 - 17342776
Alignment:
308 aaataacttaaaagaccaatatgttacaaacatcaaacttaaag 351  Q
    |||||||||||| |||||| ||||||||||| ||||||||||||    
17342733 aaataacttaaaggaccaacatgttacaaacctcaaacttaaag 17342776  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #54
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 71 - 134
Target Start/End: Original strand, 17432332 - 17432395
Alignment:
71 tgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaagg 134  Q
    |||||||  |||| |||| |||||||||||| ||||| | |||||||||||||| |||||||||    
17432332 tgtgactgaaaggtcacaggttcaagtcctggaaacaacatcttgtgtaaaaaacagggtaagg 17432395  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #55
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 308 - 355
Target Start/End: Complemental strand, 21598490 - 21598443
Alignment:
308 aaataacttaaaagaccaatatgttacaaacatcaaacttaaaggacc 355  Q
    |||||||||||| ||||||| ||||| |||| ||||||||||||||||    
21598490 aaataacttaaaggaccaatctgttataaacctcaaacttaaaggacc 21598443  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #56
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 112 - 186
Target Start/End: Complemental strand, 24751176 - 24751101
Alignment:
112 cttgtgtaaaaaatagggtaaggttgcctacaatacact-aaatgatgggactccttcccggaccctgcgtatgcg 186  Q
    ||||||||||||||||||||||  ||| ||||||||||| ||||| || ||| ||||| || ||| ||||||||||    
24751176 cttgtgtaaaaaatagggtaagactgcgtacaatacactaaaatggtgagaccccttcacgaaccgtgcgtatgcg 24751101  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #57
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 33 - 100
Target Start/End: Complemental strand, 33923009 - 33922942
Alignment:
33 gaggggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcct 100  Q
    |||||||||||| ||| |||| ||||||||||||||||| |||||  || | |||| |||||||||||    
33923009 gaggggtaaccttggcgcaaccggtaaagttgttgtcatttgactgaaaagtcacaggttcaagtcct 33922942  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #58
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 140 - 214
Target Start/End: Complemental strand, 383834 - 383760
Alignment:
140 tacaatacactaaatgatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgcccttt 214  Q
    |||||||||| ||||  |||||| ||||| | |||||||||||||||||||||| |||  |||  ||||||||||    
383834 tacaatacaccaaattgtgggaccccttctcagaccctgcgtatgcgggagcttcagtccaccgggttgcccttt 383760  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #59
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 151 - 197
Target Start/End: Complemental strand, 3116192 - 3116146
Alignment:
151 aaatgatgggactccttcccggaccctgcgtatgcgggagctttagt 197  Q
    ||||| |||||| ||||| |||||| |||||||||||||||||||||    
3116192 aaatggtgggaccccttctcggaccttgcgtatgcgggagctttagt 3116146  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #60
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 308 - 354
Target Start/End: Complemental strand, 10356366 - 10356320
Alignment:
308 aaataacttaaaagaccaatatgttacaaacatcaaacttaaaggac 354  Q
    ||||||||||||  |||||| ||||||||| ||||||||||||||||    
10356366 aaataacttaaagaaccaatctgttacaaatatcaaacttaaaggac 10356320  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #61
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 308 - 354
Target Start/End: Original strand, 35050813 - 35050859
Alignment:
308 aaataacttaaaagaccaatatgttacaaacatcaaacttaaaggac 354  Q
    |||||||||||| ||||||| |||||||||| | |||||||||||||    
35050813 aaataacttaaaggaccaatctgttacaaactttaaacttaaaggac 35050859  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #62
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 311 - 368
Target Start/End: Complemental strand, 3848590 - 3848533
Alignment:
311 taacttaaaagaccaatatgttacaaacatcaaacttaaaggacctctgatgtaattt 368  Q
    ||||||||| |||| || | |||||||| ||||||||||||||||  |||||||||||    
3848590 taacttaaatgacctattttttacaaacctcaaacttaaaggaccaatgatgtaattt 3848533  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #63
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 307 - 352
Target Start/End: Original strand, 35050757 - 35050802
Alignment:
307 gaaataacttaaaagaccaatatgttacaaacatcaaacttaaagg 352  Q
    ||||||||||||| ||||||| |||||||||| | |||||||||||    
35050757 gaaataacttaaaggaccaatctgttacaaaccttaaacttaaagg 35050802  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #64
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 308 - 368
Target Start/End: Original strand, 2761634 - 2761694
Alignment:
308 aaataacttaaaagaccaatatgttacaaacatcaaacttaaaggacctctgatgtaattt 368  Q
    ||||||| |||||||||||| | ||| |||  ||||| ||||||||||| |||||||||||    
2761634 aaataacctaaaagaccaatttattataaatttcaaatttaaaggacctatgatgtaattt 2761694  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #65
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 308 - 368
Target Start/End: Original strand, 9982962 - 9983022
Alignment:
308 aaataacttaaaagaccaatatgttacaaacatcaaacttaaaggacctctgatgtaattt 368  Q
    |||||||||||| || |||| |||||||| | ||||||||||||||||  | |||||||||    
9982962 aaataacttaaaggatcaatttgttacaatcctcaaacttaaaggacccttaatgtaattt 9983022  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #66
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 308 - 368
Target Start/End: Complemental strand, 10356306 - 10356246
Alignment:
308 aaataacttaaaagaccaatatgttacaaacatcaaacttaaaggacctctgatgtaattt 368  Q
    |||||| ||||| ||| ||| |||||||||| |||||||||||||||| ||  ||||||||    
10356306 aaataatttaaaggactaatttgttacaaacctcaaacttaaaggacccctagtgtaattt 10356246  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #67
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 36 - 124
Target Start/End: Original strand, 12063424 - 12063512
Alignment:
36 gggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaa 124  Q
    ||||||||| ||  |||||| |||||||||| ||||| ||||  |||| |||  |||||||||||  ||| |||||||||| |||||||    
12063424 gggtaaccttggtgcaactgataaagttgttatcatgagactgaaaggtcacgggttcaagtcctagaaatagcctcttgtataaaaaa 12063512  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #68
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 159 - 215
Target Start/End: Complemental strand, 20906841 - 20906785
Alignment:
159 ggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgccctttt 215  Q
    |||| ||||||| ||||| || |||||||||||||||||| |||| ||||| |||||    
20906841 ggaccccttcccagaccccgcatatgcgggagctttagtgaaccaagttgctctttt 20906785  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #69
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 324 - 368
Target Start/End: Complemental strand, 24059696 - 24059653
Alignment:
324 caatatgttacaaacatcaaacttaaaggacctctgatgtaattt 368  Q
    ||||||||||||||| |||||||||||||||| ||| ||||||||    
24059696 caatatgttacaaacctcaaacttaaaggacc-ctggtgtaattt 24059653  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #70
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 159 - 195
Target Start/End: Complemental strand, 29016337 - 29016301
Alignment:
159 ggactccttcccggaccctgcgtatgcgggagcttta 195  Q
    |||| ||||||| ||||||||||||||||||||||||    
29016337 ggaccccttcccagaccctgcgtatgcgggagcttta 29016301  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #71
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 309 - 353
Target Start/End: Complemental strand, 35225502 - 35225458
Alignment:
309 aataacttaaaagaccaatatgttacaaacatcaaacttaaagga 353  Q
    ||||||||||| ||||||| |||||||||| | ||||||||||||    
35225502 aataacttaaaggaccaatctgttacaaaccttaaacttaaagga 35225458  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0168 (Bit Score: 92; Significance: 1e-44; HSPs: 1)
Name: scaffold0168
Description:

Target: scaffold0168; HSP #1
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 33 - 215
Target Start/End: Original strand, 30533 - 30713
Alignment:
33 gaggggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaa 132  Q
    |||||||||||| ||| ||||||||||||||||||||||||||||  |||| |||  |||||||||||| ||||||||||||||||  |||| ||||||     
30533 gaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcaccggttcaagtcctggaaacagcctcttgtgt--aaaacagggtag 30630  T
133 ggttgcctacaatacactaaatgatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgccctttt 215  Q
    || ||| |||||||||| ||||| |||||| |||||||||||||||| |||||||||||| ||||| |||  |||||||||||    
30631 ggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctttt 30713  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0311 (Bit Score: 89; Significance: 9e-43; HSPs: 1)
Name: scaffold0311
Description:

Target: scaffold0311; HSP #1
Raw Score: 89; E-Value: 9e-43
Query Start/End: Original strand, 50 - 198
Target Start/End: Original strand, 10781 - 10929
Alignment:
50 caactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacac 149  Q
    |||||||||||||||||||||||||||| ||||| |||  |||||||  ||||||||| |||||||||||||||| |||||| || ||| | ||||||||    
10781 caactggtaaagttgttgtcatgtgactggaaggtcacgggttcaaggtctgaaaacaacctcttgtgtaaaaaacagggtagggctgcgtccaatacac 10880  T
150 taaatgatgggactccttcccggaccctgcgtatgcgggagctttagtg 198  Q
     ||||| |||||| |||||||||||||||||||||||||||||||||||    
10881 caaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtg 10929  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold1176 (Bit Score: 83; Significance: 3e-39; HSPs: 1)
Name: scaffold1176
Description:

Target: scaffold1176; HSP #1
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 54 - 219
Target Start/End: Complemental strand, 1745 - 1583
Alignment:
54 tggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacactaaa 153  Q
    ||||||||||||||||||||||||  |||| ||   |||||||||||||||||| |||||||||||||| |  || ||||| ||| |||||||||| |||    
1745 tggtaaagttgttgtcatgtgactgaaaggtcatgggttcaagtcctgaaaacaacctcttgtgtaaaaca--ggataaggctgcatacaatacaccaaa 1648  T
154 tgatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgcccttttattt 219  Q
    ||||||||| ||||||||||||| ||||||||||||||||||||| |||| |||| ||||||||||    
1647 tgatgggaccccttcccggacccggcgtatgcgggagctttagtgcaccaggttg-ccttttattt 1583  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0258 (Bit Score: 81; Significance: 5e-38; HSPs: 1)
Name: scaffold0258
Description:

Target: scaffold0258; HSP #1
Raw Score: 81; E-Value: 5e-38
Query Start/End: Original strand, 35 - 215
Target Start/End: Complemental strand, 13202 - 13023
Alignment:
35 ggggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaagg 134  Q
    |||||||||| ||| |||| |||||||||||||||||||||||  |||| |||  |||||||||||| ||||||||||||| || ||||| | |||||||    
13202 ggggtaaccttggcgcaaccggtaaagttgttgtcatgtgactgaaaggtcaccggttcaagtcctggaaacagcctcttgcgt-aaaaacaaggtaagg 13104  T
135 ttgcctacaatacactaaatgatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgccctttt 215  Q
     ||| ||||||||||  |||| |||||| ||||||| ||||||||||||||||| ||||||||| |||  |||||||||||    
13103 ctgcgtacaatacaccgaatggtgggaccccttcccagaccctgcgtatgcgggggctttagtgcaccgggttgccctttt 13023  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0223 (Bit Score: 76; Significance: 5e-35; HSPs: 1)
Name: scaffold0223
Description:

Target: scaffold0223; HSP #1
Raw Score: 76; E-Value: 5e-35
Query Start/End: Original strand, 40 - 214
Target Start/End: Original strand, 11093 - 11264
Alignment:
40 aacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcc 139  Q
    ||||| ||| ||||||||||||||||| | ||||||||  |||| |||  |||||||||||| |||||||||||||||||||| | ||  ||||| |||     
11093 aaccttggcgcaactggtaaagttgttct-atgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaacaaag--taaggctgct 11189  T
140 tacaatacactaaatgatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgcccttt 214  Q
    |||||||||| ||||| |||||| |||||||||||||||| |||||||||||| ||||| |||| ||||||||||    
11190 tacaatacaccaaatggtgggacaccttcccggaccctgcatatgcgggagctctagtgcaccaggttgcccttt 11264  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0049 (Bit Score: 68; Significance: 3e-30; HSPs: 1)
Name: scaffold0049
Description:

Target: scaffold0049; HSP #1
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 50 - 198
Target Start/End: Original strand, 58948 - 59098
Alignment:
50 caactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacac 149  Q
    ||||||||||| || |||||||||||||  |||| |||  |||||||||||| |||||||||||||| ||||||| ||||||||  ||| ||||||||||    
58948 caactggtaaacttattgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtataaaaaacagggtaagactgcgtacaatacac 59047  T
150 --taaatgatgggactccttcccggaccctgcgtatgcgggagctttagtg 198  Q
       ||||| |||||| ||||||| ||| |||||||||||||||||||||||    
59048 caaaaatggtgggaccccttcccagactctgcgtatgcgggagctttagtg 59098  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0187 (Bit Score: 66; Significance: 5e-29; HSPs: 4)
Name: scaffold0187
Description:

Target: scaffold0187; HSP #1
Raw Score: 66; E-Value: 5e-29
Query Start/End: Original strand, 36 - 192
Target Start/End: Complemental strand, 10226 - 10072
Alignment:
36 gggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggt 135  Q
    ||||||||| | | ||||||||||||||||||||||||||||  |||| |||  |||||||||||| ||||||||||||||||  |||| || |||||      
10226 gggtaaccttgacgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgt--aaaacagagtaagac 10129  T
136 tgcctacaatacactaaatgatgggactccttcccggaccctgcgtatgcgggagct 192  Q
    ||| |||||||||| ||||  |||||| |||||||||||||||| ||||| ||||||    
10128 tgcgtacaatacaccaaatagtgggaccccttcccggaccctgcatatgcaggagct 10072  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0187; HSP #2
Raw Score: 66; E-Value: 5e-29
Query Start/End: Original strand, 36 - 192
Target Start/End: Complemental strand, 20554 - 20400
Alignment:
36 gggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggt 135  Q
    ||||||||| | | ||||||||||||||||||||||||||||  |||| |||  |||||||||||| ||||||||||||||||  |||| || |||||      
20554 gggtaaccttgacgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgt--aaaacagagtaagac 20457  T
136 tgcctacaatacactaaatgatgggactccttcccggaccctgcgtatgcgggagct 192  Q
    ||| |||||||||| ||||  |||||| |||||||||||||||| ||||| ||||||    
20456 tgcgtacaatacaccaaatagtgggaccccttcccggaccctgcatatgcaggagct 20400  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0187; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 98
Target Start/End: Original strand, 8896 - 8964
Alignment:
30 tttgaggggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtc 98  Q
    ||||||||||||||| ||| |||| ||| |||||||||||||||||||  || | |||| |||||||||    
8896 tttgaggggtaaccttggcgcaaccggtgaagttgttgtcatgtgactgaaatgtcacaggttcaagtc 8964  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0187; HSP #4
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 98
Target Start/End: Original strand, 19224 - 19292
Alignment:
30 tttgaggggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtc 98  Q
    ||||||||||||||| ||| |||| ||| |||||||||||||||||||  || | |||| |||||||||    
19224 tttgaggggtaaccttggcgcaaccggtgaagttgttgtcatgtgactgaaatgtcacaggttcaagtc 19292  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0018 (Bit Score: 62; Significance: 1e-26; HSPs: 3)
Name: scaffold0018
Description:

Target: scaffold0018; HSP #1
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 90 - 214
Target Start/End: Complemental strand, 72992 - 72867
Alignment:
90 gttcaagtcctgaaaaca-gcctcttgtgtaaaaaatagggtaaggttgcctacaatacactaaatgatgggactccttcccggaccctgcgtatgcggg 188  Q
    |||||||||||  ||||| | ||||||||||||||| | ||||||| |||||||||||||| ||||| | | || |||||||||| ||||||||||||||    
72992 gttcaagtcctagaaacaagtctcttgtgtaaaaaacacggtaaggctgcctacaatacaccaaatggtagtaccccttcccggaacctgcgtatgcggg 72893  T
189 agctttagtgtaccatgttgcccttt 214  Q
    |||||||||| |||| ||||||||||    
72892 agctttagtgcaccaggttgcccttt 72867  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0018; HSP #2
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 308 - 355
Target Start/End: Complemental strand, 161449 - 161402
Alignment:
308 aaataacttaaaagaccaatatgttacaaacatcaaacttaaaggacc 355  Q
    |||||| ||||| ||||||| |||||||||| ||||||||||||||||    
161449 aaataagttaaaggaccaatctgttacaaacctcaaacttaaaggacc 161402  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0018; HSP #3
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 308 - 354
Target Start/End: Original strand, 161697 - 161743
Alignment:
308 aaataacttaaaagaccaatatgttacaaacatcaaacttaaaggac 354  Q
    |||||||||||| || |||| | ||||||||||||||||||||||||    
161697 aaataacttaaaggatcaatctattacaaacatcaaacttaaaggac 161743  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0015 (Bit Score: 60; Significance: 2e-25; HSPs: 1)
Name: scaffold0015
Description:

Target: scaffold0015; HSP #1
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 90 - 216
Target Start/End: Complemental strand, 48756 - 48632
Alignment:
90 gttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacactaaatgatgggactccttcccggaccctgcgtatgcggga 189  Q
    ||||||||  || |||||||||||||||||||| |  |||||||| ||| |||||||||| ||||| |||||| |||||||||||||||| |||||||||    
48756 gttcaagtggtggaaacagcctcttgtgtaaaaca--gggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcggga 48659  T
190 gctttagtgtaccatgttgccctttta 216  Q
    ||| ||||| |||  ||||||||||||    
48658 gctctagtgcaccgggttgccctttta 48632  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0954 (Bit Score: 56; Significance: 4e-23; HSPs: 1)
Name: scaffold0954
Description:

Target: scaffold0954; HSP #1
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 95 - 198
Target Start/End: Original strand, 3560 - 3663
Alignment:
95 agtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacactaaatgatgggactccttcccggaccctgcgtatgcgggagcttt 194  Q
    ||||||| ||| |||||||||||||||| ||| ||||||| ||| || |||||||  ||||||||||| |||||||| ||||||||||||||| ||||||    
3560 agtcctggaaagagcctcttgtgtaaaatataaggtaaggctgcgtataatacaccgaatgatgggaccccttcccgaaccctgcgtatgcggcagcttt 3659  T
195 agtg 198  Q
    ||||    
3660 agtg 3663  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0254 (Bit Score: 53; Significance: 3e-21; HSPs: 1)
Name: scaffold0254
Description:

Target: scaffold0254; HSP #1
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 50 - 177
Target Start/End: Original strand, 4128 - 4258
Alignment:
50 caactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacac 149  Q
    ||||| ||||||||||||| ||||||||  |||| |||  |||||||||||| ||||| |||||||||||||| | ||| ||||||||| ||||||||||    
4128 caactagtaaagttgttgttatgtgactgaaaggtcacgggttcaagtcctggaaacaacctcttgtgtaaaatacaggataaggttgcgtacaatacac 4227  T
150 ---taaatgatgggactccttcccggaccct 177  Q
       ||| || |||||| ||||||||||||||    
4228 caataattggtgggaccccttcccggaccct 4258  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0005 (Bit Score: 52; Significance: 1e-20; HSPs: 1)
Name: scaffold0005
Description:

Target: scaffold0005; HSP #1
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 32 - 162
Target Start/End: Complemental strand, 226588 - 226457
Alignment:
32 tgaggggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgt-aaaaaatagggt 130  Q
    |||| |||||||| ||| ||||||||||||||||||||||||||||  |||| |||   ||||||||||  |||||||||||||| | |||||| |||||    
226588 tgagtggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacggattcaagtcctagaaacagcctcttgtctaaaaaaacagggt 226489  T
131 aaggttgcctacaatacactaaatgatgggac 162  Q
    |||| ||| |||||||||  ||||| ||||||    
226488 aaggctgcatacaatacatcaaatggtgggac 226457  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0180 (Bit Score: 45; Significance: 2e-16; HSPs: 1)
Name: scaffold0180
Description:

Target: scaffold0180; HSP #1
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 127 - 215
Target Start/End: Complemental strand, 24220 - 24132
Alignment:
127 gggtaaggttgcctacaatacactaaatgatgggactccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgccctttt 215  Q
    |||||||| ||| |||||||||| ||||| |||||| |||||||||||||||| |||||||||||| ||||| |||   ||||||||||    
24220 gggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccggattgccctttt 24132  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0036 (Bit Score: 44; Significance: 6e-16; HSPs: 1)
Name: scaffold0036
Description:

Target: scaffold0036; HSP #1
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 50 - 183
Target Start/End: Complemental strand, 35183 - 35048
Alignment:
50 caactggtaaagttg-ttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgt-aaaaaatagggtaaggttgcctacaatac 147  Q
    ||||||||||||||  |||||||||||||  |||| |||  ||||||||||||||||||| |||||||||   |||| ||||||||| ||| ||||||||    
35183 caactggtaaagtttattgtcatgtgactgtaaggtcacgggttcaagtcctgaaaacagtctcttgtgtgtgaaaacagggtaaggctgcgtacaatac 35084  T
148 actaaatgatgggactccttcccggaccctgcgtat 183  Q
    || ||||| |||||| | |||| ||| | |||||||    
35083 accaaatggtgggaccctttcctggatcttgcgtat 35048  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0116 (Bit Score: 39; Significance: 0.0000000000006; HSPs: 1)
Name: scaffold0116
Description:

Target: scaffold0116; HSP #1
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 53 - 123
Target Start/End: Original strand, 8865 - 8935
Alignment:
53 ctggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaa 123  Q
    |||||||||||||||||||||||||  |||| |||| |||||| ||||| ||||| | |||||||||||||    
8865 ctggtaaagttgttgtcatgtgactgtaaggtcacaggttcaattcctggaaacaacttcttgtgtaaaaa 8935  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0194 (Bit Score: 37; Significance: 0.00000000001; HSPs: 1)
Name: scaffold0194
Description:

Target: scaffold0194; HSP #1
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 34 - 110
Target Start/End: Original strand, 24619 - 24695
Alignment:
34 aggggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcc 110  Q
    ||||||||||| ||||||| || |||||||||||||| ||||||  |||| |||  |||||||||||| ||||||||    
24619 aggggtaaccttggcacaattgataaagttgttgtcaagtgactgtaaggtcacgggttcaagtcctggaaacagcc 24695  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0167 (Bit Score: 37; Significance: 0.00000000001; HSPs: 1)
Name: scaffold0167
Description:

Target: scaffold0167; HSP #1
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 90 - 194
Target Start/End: Original strand, 23610 - 23714
Alignment:
90 gttcaagtcctgaaaacagcctcttgtgtaaaaaatagggtaaggttgcctacaatacactaaatgatgggactccttcccggaccctgcgtatgcggga 189  Q
    ||||||||| || ||||| |||||||||||||||| ||||| ||| ||| ||||||  |  ||||| |||||| ||||||| |||| || ||||| ||||    
23610 gttcaagtcttgcaaacaacctcttgtgtaaaaaacagggtgaggctgcgtacaatgtagcaaatggtgggaccccttcccagaccttgagtatgtggga 23709  T
190 gcttt 194  Q
    |||||    
23710 gcttt 23714  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0024 (Bit Score: 36; Significance: 0.00000000004; HSPs: 1)
Name: scaffold0024
Description:

Target: scaffold0024; HSP #1
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 32 - 107
Target Start/End: Original strand, 83828 - 83903
Alignment:
32 tgaggggtaacctcggcacaactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaaca 107  Q
    ||||||||||||| ||| ||||| ||||||||||||||||||||||  |||| |||  ||||||||| || |||||    
83828 tgaggggtaaccttggcgcaactagtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcttggaaaca 83903  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0279 (Bit Score: 35; Significance: 0.0000000002; HSPs: 1)
Name: scaffold0279
Description:

Target: scaffold0279; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 308 - 354
Target Start/End: Original strand, 1227 - 1273
Alignment:
308 aaataacttaaaagaccaatatgttacaaacatcaaacttaaaggac 354  Q
    |||||||||||| ||||||| |||||||||| |||||||||||||||    
1227 aaataacttaaaggaccaatctgttacaaacgtcaaacttaaaggac 1273  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0031 (Bit Score: 34; Significance: 0.0000000006; HSPs: 1)
Name: scaffold0031
Description:

Target: scaffold0031; HSP #1
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 50 - 123
Target Start/End: Original strand, 43100 - 43173
Alignment:
50 caactggtaaagttgttgtcatgtgactagaaggccacatgttcaagtcctgaaaacagcctcttgtgtaaaaa 123  Q
    |||||||||||||| ||||||||||| |  |||| |||  ||||| |||||  |||||||||||||||||||||    
43100 caactggtaaagttattgtcatgtgattgaaaggtcacgagttcaggtcctagaaacagcctcttgtgtaaaaa 43173  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University