View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13912_low_27 (Length: 351)
Name: NF13912_low_27
Description: NF13912
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13912_low_27 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 139; Significance: 1e-72; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 139; E-Value: 1e-72
Query Start/End: Original strand, 14 - 248
Target Start/End: Complemental strand, 38048700 - 38048451
Alignment:
| Q |
14 |
aaaaacatcaattcttttatttaatagacgttttcaacatattcttcggtgaatgtatctcctaagtgattttttccccaagnnnnnnnnnnnnnnnn-- |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38048700 |
aaaaacatcaattcttttatttaatagacgttttcaacatattcttcggtgaatgtatctcctaagtgattttttccccaagtttttttttttttttttt |
38048601 |
T |
 |
| Q |
112 |
-ggtacatttgcccaagtttatttcccaagagataaatatgaattcaacgtgcatgacatatatttaactattttattaatcgtg------------tat |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||| |
|
|
| T |
38048600 |
tggtacatttgcccaagtttatttcccaagagataaatatgaattcaacgtgcatgacatataattaactattttattaatcgtgtatgtactattttat |
38048501 |
T |
 |
| Q |
199 |
aaaataatattataacatatttacatggtcgaatcacattgaatgctttg |
248 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
38048500 |
aaaataatattataacatatttaaatggtcgaatcacattgaatgctttg |
38048451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University