View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13912_low_29 (Length: 340)
Name: NF13912_low_29
Description: NF13912
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13912_low_29 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 108; Significance: 3e-54; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 108; E-Value: 3e-54
Query Start/End: Original strand, 7 - 182
Target Start/End: Original strand, 34901419 - 34901593
Alignment:
| Q |
7 |
caataaaattcacttttgcttcgtnnnnnnnngttcttcaatttcttatgttagtttgattgacaatgtgtttatcaatttagaaaatcagatttgtaca |
106 |
Q |
| |
|
|||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34901419 |
caataaaattcacttttgcttcgtaaaaaaaagttctttaatttcttatgttagtttgattgacaatgtgtttatcaatttagaaaatcagatttgtaca |
34901518 |
T |
|
| Q |
107 |
annnnnnnnngttgagtaaaccactaaacaagatccggactctaagacactcttaaatatgatactaagaatattt |
182 |
Q |
| |
|
| ||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34901519 |
a-ttttttttgttgagtaaaccactaaactagatctggactctaagacactcttaaatatgatactaagaatattt |
34901593 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 176 - 272
Target Start/End: Original strand, 34902042 - 34902142
Alignment:
| Q |
176 |
aatatttagtaagcaacattcatagaaggatgaatttgagaaacgttttggagacatattcatattc----ttaaggaccaaattatgagcgctctataa |
271 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
34902042 |
aatatttagtaagcaacattcatagaaggatgaatttgagaaacgttttggatacatattcatattcttaattaaggaccaaattatgagcgctctataa |
34902141 |
T |
|
| Q |
272 |
a |
272 |
Q |
| |
|
| |
|
|
| T |
34902142 |
a |
34902142 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 62; E-Value: 9e-27
Query Start/End: Original strand, 276 - 337
Target Start/End: Original strand, 34902191 - 34902252
Alignment:
| Q |
276 |
tattttgatggtatactcatttcttatcctagtccaagcaactcactttgtcacaatgaatg |
337 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34902191 |
tattttgatggtatactcatttcttatcctagtccaagcaactcactttgtcacaatgaatg |
34902252 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University