View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13912_low_30 (Length: 336)
Name: NF13912_low_30
Description: NF13912
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13912_low_30 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 277 - 320
Target Start/End: Complemental strand, 44265577 - 44265534
Alignment:
| Q |
277 |
ttcgcagtcccaacaaatttgataataaatactaccttgatctt |
320 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44265577 |
ttcgtagtcccaacaaatttgataataaatactaccttgatctt |
44265534 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University