View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13912_low_40 (Length: 249)
Name: NF13912_low_40
Description: NF13912
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13912_low_40 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 132; Significance: 1e-68; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 25 - 233
Target Start/End: Original strand, 1746684 - 1746889
Alignment:
| Q |
25 |
aaaccaaagccaatattcacagcctgaaggctgaatcaaacaaaatataaat-aagtttgactaatacttgttatctatgcaattccaaccaaagaagac |
123 |
Q |
| |
|
||||||||||||||||| |||||| ||||||||||||||||||||||||||| ||||| |||||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
1746684 |
aaaccaaagccaatatt-acagcccgaaggctgaatcaaacaaaatataaatcaagttagactaataattgttatctatgcaatatcaaccaaagaagac |
1746782 |
T |
 |
| Q |
124 |
caccacattcacacttatcttcataatccagcggccaatcaattagtttaaggttattgtctattagttttgtacaaaaagaaataacataaaaattgaa |
223 |
Q |
| |
|
|||||||| ||||||||||| | ||||||||| | |||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||| |
|
|
| T |
1746783 |
caccacatccacacttatctacgtaatccagcagtcaatcaattagtttaaggttattgtc---aagttttgtccaaaaagaaataacataaaaattgaa |
1746879 |
T |
 |
| Q |
224 |
agttgatatg |
233 |
Q |
| |
|
|||||||||| |
|
|
| T |
1746880 |
agttgatatg |
1746889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University