View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13912_low_43 (Length: 238)
Name: NF13912_low_43
Description: NF13912
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13912_low_43 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 1 - 218
Target Start/End: Original strand, 47585422 - 47585637
Alignment:
| Q |
1 |
gccgggaaagtttgatattgctggccatagtcaccaactttttcatgtcttggttgtggcgggggcatatacacattaccgtgatgggttaatttacctt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47585422 |
gccgggaaagtttgatattgctggccatagtcaccaactttttcatgtcttggttgtggcgggggcatatacacattaccgtgatgggttaatttacctt |
47585521 |
T |
|
| Q |
101 |
agatggagagatttgaaaggctgttaattaggccggtagggagtctgttgtaggtactttggctttctttttgttgttcaaaacttagagatattggatg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
47585522 |
agatggagagatttgaaaggctgttaattaggccggtagggagtctgttgtaggtactttggctttctttttgttgttcaaaactt--agatattggatg |
47585619 |
T |
|
| Q |
201 |
aaagatgaagaaagtgat |
218 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
47585620 |
aaagatgaagaaagtgat |
47585637 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University