View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13913_high_3 (Length: 247)

Name: NF13913_high_3
Description: NF13913
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13913_high_3
NF13913_high_3
[»] chr3 (1 HSPs)
chr3 (23-177)||(12365098-12365252)


Alignment Details
Target: chr3 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 23 - 177
Target Start/End: Complemental strand, 12365252 - 12365098
Alignment:
23 acattacttcagttgggacaaagatgggcataatatataaaatggtggcaccccaaatataccaaagatgattttcagtaaatttagtatttggatttaa 122  Q
    ||||| ||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||| ||||||||||||    
12365252 acattgcttcagttgggacaaagatgggcataatatataaaatggcggcacaccaaatataccaaagatgattttcagtaaatttagcatttggatttaa 12365153  T
123 catgaatggtaaataaaaaggtgtatcgggaagaaaaggggaatgttctggaata 177  Q
    |||||||||||||||||||||||||||||||||||||||||| ||||||||||||    
12365152 catgaatggtaaataaaaaggtgtatcgggaagaaaaggggattgttctggaata 12365098  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University