View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13913_low_3 (Length: 247)
Name: NF13913_low_3
Description: NF13913
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13913_low_3 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 23 - 177
Target Start/End: Complemental strand, 12365252 - 12365098
Alignment:
| Q |
23 |
acattacttcagttgggacaaagatgggcataatatataaaatggtggcaccccaaatataccaaagatgattttcagtaaatttagtatttggatttaa |
122 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
12365252 |
acattgcttcagttgggacaaagatgggcataatatataaaatggcggcacaccaaatataccaaagatgattttcagtaaatttagcatttggatttaa |
12365153 |
T |
|
| Q |
123 |
catgaatggtaaataaaaaggtgtatcgggaagaaaaggggaatgttctggaata |
177 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
12365152 |
catgaatggtaaataaaaaggtgtatcgggaagaaaaggggattgttctggaata |
12365098 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University