View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13914_high_19 (Length: 244)
Name: NF13914_high_19
Description: NF13914
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13914_high_19 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 5 - 230
Target Start/End: Original strand, 23148864 - 23149099
Alignment:
| Q |
5 |
attattctattctatagtgcaatgataaaatgacagattttaagtagggtcatgcataagattctgattctaagtattggtctaattaggttcttgttgt |
104 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23148864 |
attattctattctatagtgcaatgataaaatgacagatttttagtagggtcatacataagattctgattctaagtattggtctaattaggttcttgttgt |
23148963 |
T |
|
| Q |
105 |
ttaatcttttacattaattagttacatttatttttgt----ttaattagttgccac------ggcgactttggttattttttagatttattagaattgat |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23148964 |
ttaatcttttacattaattagttacatttatttttgtttaattaattagttgccaccgtgttggcgactttggttattttttagatttattagaattgat |
23149063 |
T |
|
| Q |
195 |
ttcgattatagtacattcataatttagattcttatt |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
23149064 |
ttcgattatagtacattcataatttagattcttatt |
23149099 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University