View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13914_low_21 (Length: 242)
Name: NF13914_low_21
Description: NF13914
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13914_low_21 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 13 - 223
Target Start/End: Complemental strand, 2253175 - 2252965
Alignment:
| Q |
13 |
catcatcaaaaccggataattaaaagtaaaacaagcagacataatataaaaccagtcaccaatgtcactctacgaagcattgacacaaacatcagacatg |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2253175 |
catcatcaaaaccggataattaaaagtaaaacaagcagacataatataaaaccagtcaccaatgtcactctacgaagcattgacacaaacatcagacatg |
2253076 |
T |
 |
| Q |
113 |
acaccgatagctaggcactaaaaatggttttaaaaattaaaagtgcttgtaaggtgtcaatgtcatatcagctttggacatcgacatgtgtcagacactc |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2253075 |
acaccgatagctaggcactaaaaatggttttaaaaattaaaagtgcttgtaaggtgtcaatgtcatatcagctttggacatcgacatgtgtcagacactc |
2252976 |
T |
 |
| Q |
213 |
aaatacacttt |
223 |
Q |
| |
|
|||||| |||| |
|
|
| T |
2252975 |
aaatacgcttt |
2252965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University