View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13914_low_23 (Length: 229)
Name: NF13914_low_23
Description: NF13914
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13914_low_23 |
 | |
|
| [»] chr5 (2 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 218; Significance: 1e-120; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 8 - 229
Target Start/End: Original strand, 41442894 - 41443115
Alignment:
| Q |
8 |
gagcacagacttctcataaaagaaaatgctacaaggtatttgtatccaaagcacaatttcattgacaacaaatttataggatcaacactaactccaaata |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
41442894 |
gagcacagacttctcataaaagaaaatgctacaaggtatttgtatccaaagcacaatttcattgacaacaaatttataggatcaacactaactccaatta |
41442993 |
T |
|
| Q |
108 |
gtggaaaggctatatagactattatagaggtgtcatgtaggcagaattctagcttaagaataaattttcaacaaagggtggaacggttacatgagattga |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41442994 |
gtggaaaggctatatagactattatagaggtgtcatgtaggcagaattctagcttaagaataaattttcaacaaagggtggaacggttacatgagattga |
41443093 |
T |
|
| Q |
208 |
aacataggcagaattcaaggtc |
229 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
41443094 |
aacataggcagaattcaaggtc |
41443115 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 8 - 65
Target Start/End: Original strand, 41449015 - 41449072
Alignment:
| Q |
8 |
gagcacagacttctcataaaagaaaatgctacaaggtatttgtatccaaagcacaatt |
65 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
41449015 |
gagcacagacatctcataaaagaaaatgctacaaagtatttgtatccaaagcacaatt |
41449072 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University