View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13914_low_25 (Length: 224)
Name: NF13914_low_25
Description: NF13914
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13914_low_25 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 15 - 208
Target Start/End: Original strand, 41908915 - 41909108
Alignment:
| Q |
15 |
atgaactgaattgaaaacttgttattcaagaactttgaagtttgaatgtagaagtataaaaaggacctatttggttttacggctgtggctttgatcagat |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
41908915 |
atgaactgaattgaaaacttgttattcaagaactttgaagtttgaatgtagaagtataaaaaggacctatttggtgttacggctgttgctttgatcagat |
41909014 |
T |
|
| Q |
115 |
gttatggaattttcgatgtggttgaactgtcatcttgtgcttgccactacagttcaacaatggaaatttggcataaatagaggaaaatgcttca |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41909015 |
gttatggaattttcgatgtggttgaactgtcatcttgtgcttgccactacagttcaacaatggaaatttggcataaatagaggaaaatgcttca |
41909108 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University