View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13915_high_16 (Length: 246)

Name: NF13915_high_16
Description: NF13915
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13915_high_16
NF13915_high_16
[»] chr1 (1 HSPs)
chr1 (114-237)||(33444207-33444330)
[»] chr3 (1 HSPs)
chr3 (155-220)||(2229712-2229777)
[»] chr5 (1 HSPs)
chr5 (126-213)||(40560964-40561051)


Alignment Details
Target: chr1 (Bit Score: 120; Significance: 2e-61; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 114 - 237
Target Start/End: Original strand, 33444207 - 33444330
Alignment:
114 gtactaaggttaatttggttgtgttgacaaggatgctactggagttcctgctcttgttgatttggcttctatgagggatgccatgaagaatcttggtggt 213  Q
    ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33444207 gtactaaggttaatttgtttgtgttgacaaggatgctactggagttcctgctcttgttgatttggcttctatgagggatgccatgaagaatcttggtggt 33444306  T
214 gatcctaacaagattagccctttg 237  Q
    ||||||||||||||||||||||||    
33444307 gatcctaacaagattagccctttg 33444330  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 46; Significance: 2e-17; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 155 - 220
Target Start/End: Original strand, 2229712 - 2229777
Alignment:
155 gagttcctgctcttgttgatttggcttctatgagggatgccatgaagaatcttggtggtgatccta 220  Q
    |||||||||||||| ||||| | ||||||||||| ||||| |||||||||||||||||||||||||    
2229712 gagttcctgctctttttgatcttgcttctatgagagatgctatgaagaatcttggtggtgatccta 2229777  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 126 - 213
Target Start/End: Complemental strand, 40561051 - 40560964
Alignment:
126 atttggttgtgttgacaaggatgctactggagttcctgctcttgttgatttggcttctatgagggatgccatgaagaatcttggtggt 213  Q
    ||||||| ||| ||||||||||||||||| | || ||| |||||||||| |  |||||||||||||| ||| ||||| |||| |||||    
40561051 atttggtagtgctgacaaggatgctactgcattttctgttcttgttgatgtaacttctatgagggattccacgaagattctttgtggt 40560964  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University